ID: 1104354713

View in Genome Browser
Species Human (GRCh38)
Location 12:128075318-128075340
Sequence GGTGTGAGCATTTTTACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354713_1104354722 15 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data
1104354713_1104354726 29 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354726 12:128075370-128075392 GTCACATGGAAAAGGGGAATTGG No data
1104354713_1104354724 22 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG No data
1104354713_1104354723 21 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354713_1104354725 23 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354725 12:128075364-128075386 TGTTAAGTCACATGGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354713 Original CRISPR GGTGTGAGCATTTTTACAGG GGG (reversed) Intergenic
No off target data available for this crispr