ID: 1104354719

View in Genome Browser
Species Human (GRCh38)
Location 12:128075346-128075368
Sequence TAACATACTCACAGGTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354719_1104354728 14 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354728 12:128075383-128075405 GGGGAATTGGAGTTCCAAGGAGG No data
1104354719_1104354727 11 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data
1104354719_1104354729 15 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354729 12:128075384-128075406 GGGAATTGGAGTTCCAAGGAGGG No data
1104354719_1104354726 1 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354726 12:128075370-128075392 GTCACATGGAAAAGGGGAATTGG No data
1104354719_1104354724 -6 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG No data
1104354719_1104354725 -5 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354725 12:128075364-128075386 TGTTAAGTCACATGGAAAAGGGG No data
1104354719_1104354723 -7 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354719 Original CRISPR TAACATACTCACAGGTTTCA GGG (reversed) Intergenic
No off target data available for this crispr