ID: 1104354720

View in Genome Browser
Species Human (GRCh38)
Location 12:128075347-128075369
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354720_1104354724 -7 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG No data
1104354720_1104354725 -6 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354725 12:128075364-128075386 TGTTAAGTCACATGGAAAAGGGG No data
1104354720_1104354726 0 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354726 12:128075370-128075392 GTCACATGGAAAAGGGGAATTGG No data
1104354720_1104354723 -8 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354720_1104354729 14 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354729 12:128075384-128075406 GGGAATTGGAGTTCCAAGGAGGG No data
1104354720_1104354728 13 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354728 12:128075383-128075405 GGGGAATTGGAGTTCCAAGGAGG No data
1104354720_1104354727 10 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354720 Original CRISPR TTAACATACTCACAGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr