ID: 1104354722

View in Genome Browser
Species Human (GRCh38)
Location 12:128075356-128075378
Sequence TGTGAGTATGTTAAGTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354714_1104354722 14 Left 1104354714 12:128075319-128075341 CCCCTGTAAAAATGCTCACACCC No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data
1104354718_1104354722 -7 Left 1104354718 12:128075340-128075362 CCTAGTCCCTGAAACCTGTGAGT No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data
1104354717_1104354722 -6 Left 1104354717 12:128075339-128075361 CCCTAGTCCCTGAAACCTGTGAG No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data
1104354716_1104354722 12 Left 1104354716 12:128075321-128075343 CCTGTAAAAATGCTCACACCCTA No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data
1104354713_1104354722 15 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data
1104354715_1104354722 13 Left 1104354715 12:128075320-128075342 CCCTGTAAAAATGCTCACACCCT No data
Right 1104354722 12:128075356-128075378 TGTGAGTATGTTAAGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354722 Original CRISPR TGTGAGTATGTTAAGTCACA TGG Intergenic
No off target data available for this crispr