ID: 1104354723

View in Genome Browser
Species Human (GRCh38)
Location 12:128075362-128075384
Sequence TATGTTAAGTCACATGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354719_1104354723 -7 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354716_1104354723 18 Left 1104354716 12:128075321-128075343 CCTGTAAAAATGCTCACACCCTA No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354714_1104354723 20 Left 1104354714 12:128075319-128075341 CCCCTGTAAAAATGCTCACACCC No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354717_1104354723 0 Left 1104354717 12:128075339-128075361 CCCTAGTCCCTGAAACCTGTGAG No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354715_1104354723 19 Left 1104354715 12:128075320-128075342 CCCTGTAAAAATGCTCACACCCT No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354718_1104354723 -1 Left 1104354718 12:128075340-128075362 CCTAGTCCCTGAAACCTGTGAGT No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354713_1104354723 21 Left 1104354713 12:128075318-128075340 CCCCCTGTAAAAATGCTCACACC No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data
1104354720_1104354723 -8 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354723 12:128075362-128075384 TATGTTAAGTCACATGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354723 Original CRISPR TATGTTAAGTCACATGGAAA AGG Intergenic
No off target data available for this crispr