ID: 1104354727

View in Genome Browser
Species Human (GRCh38)
Location 12:128075380-128075402
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354719_1104354727 11 Left 1104354719 12:128075346-128075368 CCCTGAAACCTGTGAGTATGTTA No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data
1104354718_1104354727 17 Left 1104354718 12:128075340-128075362 CCTAGTCCCTGAAACCTGTGAGT No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data
1104354721_1104354727 3 Left 1104354721 12:128075354-128075376 CCTGTGAGTATGTTAAGTCACAT No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data
1104354720_1104354727 10 Left 1104354720 12:128075347-128075369 CCTGAAACCTGTGAGTATGTTAA No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data
1104354717_1104354727 18 Left 1104354717 12:128075339-128075361 CCCTAGTCCCTGAAACCTGTGAG No data
Right 1104354727 12:128075380-128075402 AAAGGGGAATTGGAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354727 Original CRISPR AAAGGGGAATTGGAGTTCCA AGG Intergenic
No off target data available for this crispr