ID: 1104354984 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:128077401-128077423 |
Sequence | GGCACGTCGGATAGTGAGAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104354976_1104354984 | 11 | Left | 1104354976 | 12:128077367-128077389 | CCTTCTGATGTCTGGCTCAGGCA | No data | ||
Right | 1104354984 | 12:128077401-128077423 | GGCACGTCGGATAGTGAGAGAGG | No data | ||||
1104354975_1104354984 | 12 | Left | 1104354975 | 12:128077366-128077388 | CCCTTCTGATGTCTGGCTCAGGC | No data | ||
Right | 1104354984 | 12:128077401-128077423 | GGCACGTCGGATAGTGAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104354984 | Original CRISPR | GGCACGTCGGATAGTGAGAG AGG | Intergenic | ||