ID: 1104354984

View in Genome Browser
Species Human (GRCh38)
Location 12:128077401-128077423
Sequence GGCACGTCGGATAGTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104354976_1104354984 11 Left 1104354976 12:128077367-128077389 CCTTCTGATGTCTGGCTCAGGCA No data
Right 1104354984 12:128077401-128077423 GGCACGTCGGATAGTGAGAGAGG No data
1104354975_1104354984 12 Left 1104354975 12:128077366-128077388 CCCTTCTGATGTCTGGCTCAGGC No data
Right 1104354984 12:128077401-128077423 GGCACGTCGGATAGTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104354984 Original CRISPR GGCACGTCGGATAGTGAGAG AGG Intergenic