ID: 1104356529

View in Genome Browser
Species Human (GRCh38)
Location 12:128091481-128091503
Sequence GGCTTGCTTGTTATTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104356529_1104356532 4 Left 1104356529 12:128091481-128091503 CCAGCCACAATAACAAGCAAGCC No data
Right 1104356532 12:128091508-128091530 GAAGCACTGAAATAATTGCATGG No data
1104356529_1104356533 16 Left 1104356529 12:128091481-128091503 CCAGCCACAATAACAAGCAAGCC No data
Right 1104356533 12:128091520-128091542 TAATTGCATGGTCTAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104356529 Original CRISPR GGCTTGCTTGTTATTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr