ID: 1104356623

View in Genome Browser
Species Human (GRCh38)
Location 12:128092456-128092478
Sequence CTGAATATAAAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104356614_1104356623 26 Left 1104356614 12:128092407-128092429 CCTCCCCGTGTCAATTTCATCTG No data
Right 1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG No data
1104356617_1104356623 21 Left 1104356617 12:128092412-128092434 CCGTGTCAATTTCATCTGCAGTA No data
Right 1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG No data
1104356616_1104356623 22 Left 1104356616 12:128092411-128092433 CCCGTGTCAATTTCATCTGCAGT No data
Right 1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG No data
1104356615_1104356623 23 Left 1104356615 12:128092410-128092432 CCCCGTGTCAATTTCATCTGCAG No data
Right 1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG No data
1104356613_1104356623 27 Left 1104356613 12:128092406-128092428 CCCTCCCCGTGTCAATTTCATCT No data
Right 1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104356623 Original CRISPR CTGAATATAAAAATGGACAA TGG Intergenic
No off target data available for this crispr