ID: 1104356635

View in Genome Browser
Species Human (GRCh38)
Location 12:128092594-128092616
Sequence TGATCTTGAGTAGAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104356635_1104356638 -2 Left 1104356635 12:128092594-128092616 CCCTCACTTTCTACTCAAGATCA No data
Right 1104356638 12:128092615-128092637 CAACCAGAGGCAGCCAAATATGG No data
1104356635_1104356642 16 Left 1104356635 12:128092594-128092616 CCCTCACTTTCTACTCAAGATCA No data
Right 1104356642 12:128092633-128092655 TATGGGCCCCAGAATAATCCTGG No data
1104356635_1104356639 -1 Left 1104356635 12:128092594-128092616 CCCTCACTTTCTACTCAAGATCA No data
Right 1104356639 12:128092616-128092638 AACCAGAGGCAGCCAAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104356635 Original CRISPR TGATCTTGAGTAGAAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr