ID: 1104356640

View in Genome Browser
Species Human (GRCh38)
Location 12:128092618-128092640
Sequence GGCCCATATTTGGCTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104356640_1104356642 -8 Left 1104356640 12:128092618-128092640 CCAGAGGCAGCCAAATATGGGCC No data
Right 1104356642 12:128092633-128092655 TATGGGCCCCAGAATAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104356640 Original CRISPR GGCCCATATTTGGCTGCCTC TGG (reversed) Intergenic
No off target data available for this crispr