ID: 1104356642

View in Genome Browser
Species Human (GRCh38)
Location 12:128092633-128092655
Sequence TATGGGCCCCAGAATAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104356635_1104356642 16 Left 1104356635 12:128092594-128092616 CCCTCACTTTCTACTCAAGATCA No data
Right 1104356642 12:128092633-128092655 TATGGGCCCCAGAATAATCCTGG No data
1104356636_1104356642 15 Left 1104356636 12:128092595-128092617 CCTCACTTTCTACTCAAGATCAA No data
Right 1104356642 12:128092633-128092655 TATGGGCCCCAGAATAATCCTGG No data
1104356640_1104356642 -8 Left 1104356640 12:128092618-128092640 CCAGAGGCAGCCAAATATGGGCC No data
Right 1104356642 12:128092633-128092655 TATGGGCCCCAGAATAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104356642 Original CRISPR TATGGGCCCCAGAATAATCC TGG Intergenic
No off target data available for this crispr