ID: 1104356919

View in Genome Browser
Species Human (GRCh38)
Location 12:128095087-128095109
Sequence CAAAAACAGAATTGGAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104356919_1104356922 -4 Left 1104356919 12:128095087-128095109 CCTTGGTTCCAATTCTGTTTTTG No data
Right 1104356922 12:128095106-128095128 TTTGGTCTTTATAACAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104356919 Original CRISPR CAAAAACAGAATTGGAACCA AGG (reversed) Intergenic
No off target data available for this crispr