ID: 1104358732

View in Genome Browser
Species Human (GRCh38)
Location 12:128112248-128112270
Sequence TCATATACACAGGGAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104358727_1104358732 29 Left 1104358727 12:128112196-128112218 CCTCATAACAGTGTACGTCTTTC No data
Right 1104358732 12:128112248-128112270 TCATATACACAGGGAGTGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104358732 Original CRISPR TCATATACACAGGGAGTGCA GGG Intergenic
904956739 1:34290832-34290854 TCATATGCTCAGGGAGAGAAGGG + Intergenic
906343006 1:44997109-44997131 TCATATAAACAGAGAGGGCTAGG + Intergenic
906362709 1:45177381-45177403 CCATATACACAGGGAATTTAAGG + Intronic
906950219 1:50329007-50329029 TCACTTGCCCAGGGAGTGCAGGG - Intergenic
907107778 1:51899768-51899790 TCATTTACAAAATGAGTGCAGGG - Intergenic
907953978 1:59210770-59210792 ACATGTACACAGGGAGGGGAAGG + Intergenic
909463011 1:75940901-75940923 TCATGGACACAGAGAGTGGAAGG - Intergenic
913456705 1:119039453-119039475 ACATATACACAGAGAGAGAAAGG + Intronic
919452779 1:197790038-197790060 TCATATAAACAGAGAGTAAAAGG - Intergenic
1064443914 10:15376708-15376730 TCATATAGACAAAAAGTGCAAGG + Intergenic
1065093290 10:22255715-22255737 TAATATATACAGGAAGTTCAAGG + Intergenic
1067698155 10:48550194-48550216 TAATGCACGCAGGGAGTGCATGG - Intronic
1068478459 10:57558925-57558947 TCATAGACATAGGGAGTAGAAGG - Intergenic
1069651246 10:70051422-70051444 TCATACACAGAGGGCGTGAAAGG + Intergenic
1070252767 10:74787433-74787455 TAATATACACAGGCCGGGCATGG - Intergenic
1070579308 10:77707797-77707819 TCATGGACACAGAGAGTGGAAGG + Intergenic
1072612302 10:97026095-97026117 ACATATACACAGGAAATGGAAGG - Intronic
1077261282 11:1622226-1622248 TCACATACCCAGGAAGTGCTGGG - Intergenic
1080785565 11:35472185-35472207 TAACACACACAGTGAGTGCATGG - Intronic
1082698194 11:56396739-56396761 TTATATAAACAGCGAGTTCACGG - Intergenic
1084690908 11:70725994-70726016 TCACACACACAGGCAGTGGAGGG + Intronic
1085126156 11:74004088-74004110 TCCTATGCTCAGGGAGTTCACGG - Intronic
1087362316 11:97176572-97176594 ACATATACACAGGGAAAACAAGG - Intergenic
1087657653 11:100944508-100944530 TCATATACAAAGGGTATACATGG - Intronic
1089562967 11:119354866-119354888 TCATATACGCAGGTTCTGCAGGG + Intergenic
1089748429 11:120633289-120633311 TCAGAGACACAGTGAGTGCAGGG + Intronic
1091193306 11:133712068-133712090 CCAAATGCACAGGGAGTGGATGG + Intergenic
1091624579 12:2112351-2112373 GGATCTACACAGTGAGTGCAGGG + Intronic
1091865285 12:3829105-3829127 TCATAGAGACAGGGAATGGAGGG + Intronic
1094667707 12:32537796-32537818 TCCTATATACAGGGAGGACAAGG - Intronic
1098081811 12:66794444-66794466 TCACATACACAGGGGCTCCAGGG + Intronic
1101824968 12:108213060-108213082 TGGTATACAAAGAGAGTGCAGGG + Intronic
1104358732 12:128112248-128112270 TCATATACACAGGGAGTGCAGGG + Intergenic
1106815798 13:33405386-33405408 TCACACACACAGGGCCTGCAGGG + Intergenic
1109580367 13:64323567-64323589 TAAGATACACAGAGAGTGGAAGG + Intergenic
1112032405 13:95469663-95469685 GCATTTACACAAGGAGAGCAAGG - Intronic
1112092196 13:96093087-96093109 TAATCTAAACAGGGAGTACAAGG - Intronic
1113868350 13:113543390-113543412 TCATGGACAGAGGGAGGGCAGGG - Intronic
1113939371 13:114010551-114010573 TCATATCCACAGGGAGAGAGGGG + Intronic
1115463581 14:33688780-33688802 TCATTTACACAGGCAGAGCATGG + Intronic
1118652473 14:67911966-67911988 TCATATACACAGCTATAGCAGGG - Intronic
1118963426 14:70556770-70556792 TCGTATACACAGGTTCTGCAGGG + Intergenic
1120137898 14:80891496-80891518 TCAAATTCACAGAGAGTACAAGG + Intronic
1121191416 14:92034035-92034057 ACACATACAGAGGGAGTGCTCGG - Intronic
1121683065 14:95810420-95810442 ACTTACACACAGGGAGTGCCAGG - Intergenic
1123774595 15:23566091-23566113 TTATATACATGGGCAGTGCAAGG + Exonic
1124460254 15:29883335-29883357 TGAAATGCACAGGGAATGCAGGG + Intronic
1133754601 16:8753023-8753045 TGGCATACACAGGGAGTCCAAGG + Intronic
1135026912 16:19005839-19005861 TCATATCCTCAGGGTGTGCCAGG + Intronic
1135725313 16:24849759-24849781 GCATATGCCCAGTGAGTGCAGGG - Intronic
1138200894 16:55087586-55087608 TTTTATAGACAGTGAGTGCAGGG + Intergenic
1138778275 16:59751999-59752021 TGATAGACACAAGGATTGCAGGG - Exonic
1139580214 16:67868657-67868679 TCACATCCACAGGGAAAGCAGGG - Intronic
1140709898 16:77667720-77667742 ACATAAACACAGGCAGTCCAGGG + Intergenic
1141967704 16:87458171-87458193 TAAGATTCACAGGGTGTGCAGGG + Intronic
1143288328 17:5809219-5809241 TCACATCCACAGTGAGTGCTGGG - Intronic
1146106284 17:30040120-30040142 TCAAGTAGACATGGAGTGCATGG + Intronic
1146372092 17:32271219-32271241 TCAGATGCAGATGGAGTGCAGGG - Intronic
1149254117 17:54805401-54805423 TCATTTACATAGGGTGTACATGG + Intergenic
1149881449 17:60296257-60296279 TCACATACACAGGGACTTCAAGG - Intronic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1159166506 18:64708427-64708449 TTATCTACACTGGGTGTGCAGGG - Intergenic
1160110714 18:76027370-76027392 TCATGGACACAGAGAGTGGAAGG + Intergenic
1161137951 19:2631613-2631635 TTATACAAACAGGGAGTGGAGGG + Intronic
1164891200 19:31825184-31825206 ACCTAAACACAGGGTGTGCATGG - Intergenic
1166411739 19:42560145-42560167 TCATGTCCATAGGGAGGGCATGG + Intronic
1166955050 19:46458227-46458249 TGAGACACACAGGGAGGGCAGGG + Intergenic
1166995923 19:46719735-46719757 ACAGATATACAGGGAGTTCAGGG + Exonic
1168488421 19:56785732-56785754 TCACATACACAGGTATTGGATGG + Intronic
927410406 2:22818400-22818422 TTGTATACACAGGAAGTACAGGG - Intergenic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
930459807 2:51658625-51658647 TCATATATAGAGAGAGTACATGG - Intergenic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
933587219 2:84192430-84192452 TTCTATAGACAGGGAGTGCAAGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
944315814 2:198284833-198284855 GCATATATACAGGCAGGGCATGG + Intronic
945197359 2:207249796-207249818 ACACATACACAGGGAGAACATGG + Intergenic
948737484 2:240018463-240018485 TCATAAACACAGTAAGTGCAAGG + Intronic
1169668117 20:8062507-8062529 TCATATAGACATGGTGTGCCTGG - Intergenic
1173374187 20:42468851-42468873 TCATATTCACAGGGAATTCCTGG - Intronic
1176376301 21:6088406-6088428 TCAGATACACAGGAAGGGCCGGG + Intergenic
1178003282 21:28188507-28188529 TCATGAACACAGAGAGTGGAAGG - Intergenic
1178050129 21:28737867-28737889 TAATATACACAAAGAATGCAAGG + Intergenic
1179150078 21:38802291-38802313 TCATGCCCACAGGGAGTGCAAGG + Intergenic
1179747174 21:43449838-43449860 TCAGATACACAGGAAGGGCCGGG - Intergenic
1182966255 22:34524066-34524088 TCACATGCATAGGGACTGCATGG - Intergenic
953645942 3:44754996-44755018 ACACATATACAGGGAGTACATGG - Intronic
958048429 3:88315550-88315572 TCATATTTATAGGGAGTACATGG + Intergenic
959153844 3:102641914-102641936 TTATATACAGAGGGTCTGCAGGG + Intergenic
960737884 3:120800393-120800415 TAATGTACACAGTGAGTGAAAGG - Intergenic
962689183 3:137876661-137876683 TCATGGACACAGAGAGTACAAGG + Intergenic
962895438 3:139709787-139709809 TCATTTCCACAGGGAGAACATGG + Intergenic
963044569 3:141093157-141093179 ACATTTGCAGAGGGAGTGCAGGG + Intronic
965236443 3:166130101-166130123 TCATAGACATAGAGAGTGGAGGG - Intergenic
967070542 3:185958864-185958886 TCATTTATTCAGGGAGTGTAGGG - Intergenic
969694450 4:8726668-8726690 TCATATGCACAGGGAGCCTATGG - Intergenic
972228168 4:37038971-37038993 TCATAGACACAGGGAGCAGAAGG - Intergenic
972741651 4:41892881-41892903 TCATATACTCAGGGATCACAAGG - Intergenic
975513688 4:75221398-75221420 TCATAGACACAGAGAGTATAAGG + Intergenic
975673286 4:76802784-76802806 GCAAATACACAGGGAGGGGAGGG + Intergenic
976484061 4:85580101-85580123 ACACATACACAGGGTGTGGAGGG - Intronic
976637426 4:87300880-87300902 CCTTATACACAGGGAGAGAAAGG - Intergenic
978467407 4:109022981-109023003 TGATATAAACAGGAAGTGTATGG - Intronic
978471747 4:109075702-109075724 AAATATACACAGGAAGTGAAAGG - Intronic
979588603 4:122450656-122450678 TCATATATTCAAGGAATGCAAGG - Intergenic
980900218 4:138897826-138897848 TCAGAAACTCAGGGAGTGCCTGG + Intergenic
985110187 4:186540287-186540309 ACATATTCACAGGGTCTGCAGGG - Intronic
987397733 5:17441465-17441487 CCAGATATACAGGGAGTCCACGG + Intergenic
987662620 5:20896266-20896288 TCATAGACACGGGGATGGCAGGG - Intergenic
989238955 5:39181567-39181589 TCAAATAAGCAGGCAGTGCAAGG - Intronic
993230736 5:85231926-85231948 TCATATAAACAGAGAGTACAAGG - Intergenic
997198184 5:131993621-131993643 CCATGTACTCAGGGAGAGCAGGG + Intronic
999027286 5:148248567-148248589 TGATATACACAGGCTGGGCATGG - Intergenic
999128414 5:149264218-149264240 TCATATAGACAGGGGGTCCCTGG + Intergenic
999408652 5:151329941-151329963 TCATATACTCAGGTTCTGCAGGG + Intronic
999448684 5:151662256-151662278 GTTTATACACAGGGAGTGTATGG - Exonic
999620376 5:153466739-153466761 TGGCATACCCAGGGAGTGCATGG - Intergenic
999776694 5:154817688-154817710 TCATGTGCACATTGAGTGCAGGG - Intergenic
1000173527 5:158727591-158727613 TCATATACACAGGGAGAAAAGGG - Intronic
1000202635 5:159026837-159026859 TTAGAGACACAGGGAGGGCAAGG - Intronic
1001209370 5:169795835-169795857 TCAATTACACAGGGAGGGCAGGG + Intronic
1002851006 6:996334-996356 TCCTTTACACAGGCAGTGCTGGG + Intergenic
1008459844 6:51755620-51755642 TCATATTCAGAGGGAATGCTAGG - Intronic
1010280431 6:74017482-74017504 TCATAAAGGCAGGGAGTGGAAGG - Intergenic
1014699873 6:124671696-124671718 CTATATACTCAGAGAGTGCAGGG - Intronic
1017790066 6:157790143-157790165 ACATGGCCACAGGGAGTGCAAGG + Intronic
1018180959 6:161223070-161223092 GGAGGTACACAGGGAGTGCAGGG - Intronic
1019541686 7:1554540-1554562 TCAGATACACAGAGAGGCCAGGG - Intronic
1024857210 7:53795615-53795637 TCAAACACACAGGGAGAGAAAGG - Intergenic
1031387422 7:121168763-121168785 TCATAGACACAGAGAGTAGAAGG - Intronic
1032644468 7:133807092-133807114 TCATATACGCAGGTTCTGCAGGG + Intronic
1034889935 7:154830779-154830801 TCCTCTCCACAGGGCGTGCACGG - Intronic
1035453506 7:158994699-158994721 TAATATACCCAGGGATTGCAGGG - Intergenic
1036481394 8:9142699-9142721 TCATAGAAACAGAGAGTACAGGG - Intronic
1036824604 8:11966397-11966419 TCATAGACACGGTCAGTGCATGG + Intergenic
1038429877 8:27491447-27491469 TCATATGCACTGGGACTTCAGGG - Intronic
1042257663 8:66822146-66822168 ACATATAAACAGGCAGTTCATGG - Intronic
1044198350 8:89404712-89404734 TCTTTTACAGAGGGAGAGCAGGG - Intergenic
1048454130 8:134562642-134562664 TAAAATCCACAGGGAGTCCAAGG + Intronic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1051742296 9:20263652-20263674 TCATGTAAACATGTAGTGCATGG - Intergenic
1057849098 9:98550810-98550832 TCATAATCACAGGGAATGCAGGG - Intronic
1057919142 9:99082364-99082386 TCAAATACACAGGAAGGGCTAGG - Intergenic
1058781461 9:108340438-108340460 TTATATACACAGTGAGTTCAAGG + Intergenic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1059720551 9:116955832-116955854 TTATATCCACAGAAAGTGCATGG - Intronic
1061906299 9:133701036-133701058 TCACATACTCAGGGAGGCCAGGG + Intronic
1187841413 X:23492833-23492855 TAATATACTGAAGGAGTGCAGGG - Intergenic
1187905801 X:24065322-24065344 ACATATACACAGGCTGGGCATGG + Intronic
1188394984 X:29671173-29671195 TGATATAATCAGGAAGTGCATGG + Intronic
1189091156 X:38084241-38084263 TGGTACACACAGGGAGGGCATGG + Intronic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1190654249 X:52597229-52597251 TCACATACAGAAGGAGAGCAGGG + Intergenic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1191051900 X:56202612-56202634 TCATAGACACAGAGAGTAGAAGG - Intergenic
1193318203 X:80089539-80089561 TCATGTACACAGAGAGTAGAAGG + Intergenic
1193738541 X:85189308-85189330 TCATATAACCAGGGATAGCATGG - Intergenic
1193824524 X:86206425-86206447 TCATTTAGACAGGCAATGCAAGG - Intronic
1195315544 X:103674324-103674346 TGATATACAAAGGAAGTTCAAGG - Intergenic
1195495723 X:105530763-105530785 TCATGTACATAGAGAGTACAAGG - Intronic
1195672818 X:107483895-107483917 ACATATACACTGGGTGTGCAAGG + Intergenic
1197264291 X:124349474-124349496 TCATATACACATGGACAACAAGG + Intronic
1197703586 X:129617688-129617710 ACATAAACACAGGCAGAGCAGGG + Intergenic
1197730076 X:129802272-129802294 ACATATACCAAGGGAGTGCTAGG - Intergenic
1199549541 X:149043730-149043752 TTATTTACACAGGAAGTGAAGGG - Intergenic
1200032469 X:153307406-153307428 AGATATTCACTGGGAGTGCAGGG - Intergenic