ID: 1104364097

View in Genome Browser
Species Human (GRCh38)
Location 12:128161456-128161478
Sequence CCTAACCTGCCCAAGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104364097_1104364099 10 Left 1104364097 12:128161456-128161478 CCATGTATCTTGGGCAGGTTAGG No data
Right 1104364099 12:128161489-128161511 GCAAACAATTTTCTTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104364097 Original CRISPR CCTAACCTGCCCAAGATACA TGG (reversed) Intergenic
No off target data available for this crispr