ID: 1104365713

View in Genome Browser
Species Human (GRCh38)
Location 12:128174705-128174727
Sequence TGCCATGGCAACACCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104365708_1104365713 0 Left 1104365708 12:128174682-128174704 CCACCCTAGGATGGCACTCTGCC No data
Right 1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG No data
1104365705_1104365713 21 Left 1104365705 12:128174661-128174683 CCATGTCTTAGAATCTGAGTTCC No data
Right 1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG No data
1104365710_1104365713 -4 Left 1104365710 12:128174686-128174708 CCTAGGATGGCACTCTGCCTGCC No data
Right 1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG No data
1104365709_1104365713 -3 Left 1104365709 12:128174685-128174707 CCCTAGGATGGCACTCTGCCTGC No data
Right 1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG No data
1104365704_1104365713 26 Left 1104365704 12:128174656-128174678 CCAGGCCATGTCTTAGAATCTGA No data
Right 1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG No data
1104365703_1104365713 27 Left 1104365703 12:128174655-128174677 CCCAGGCCATGTCTTAGAATCTG No data
Right 1104365713 12:128174705-128174727 TGCCATGGCAACACCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104365713 Original CRISPR TGCCATGGCAACACCATGCC TGG Intergenic
No off target data available for this crispr