ID: 1104366731

View in Genome Browser
Species Human (GRCh38)
Location 12:128184752-128184774
Sequence GACTCTGTGCCTCTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104366731_1104366736 17 Left 1104366731 12:128184752-128184774 CCTGTGAGAAGAGGCACAGAGTC No data
Right 1104366736 12:128184792-128184814 GCAACGTGAGCACAGACAATGGG No data
1104366731_1104366737 29 Left 1104366731 12:128184752-128184774 CCTGTGAGAAGAGGCACAGAGTC No data
Right 1104366737 12:128184804-128184826 CAGACAATGGGAGAAACACCAGG No data
1104366731_1104366732 -5 Left 1104366731 12:128184752-128184774 CCTGTGAGAAGAGGCACAGAGTC No data
Right 1104366732 12:128184770-128184792 GAGTCAGACCCACGCAGAGAAGG No data
1104366731_1104366735 16 Left 1104366731 12:128184752-128184774 CCTGTGAGAAGAGGCACAGAGTC No data
Right 1104366735 12:128184791-128184813 GGCAACGTGAGCACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104366731 Original CRISPR GACTCTGTGCCTCTTCTCAC AGG (reversed) Intergenic
No off target data available for this crispr