ID: 1104366961

View in Genome Browser
Species Human (GRCh38)
Location 12:128186842-128186864
Sequence GGCTTCTTCAACAGAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104366961_1104366968 17 Left 1104366961 12:128186842-128186864 CCATCTCTTCTGTTGAAGAAGCC No data
Right 1104366968 12:128186882-128186904 GGAGACTGACCAGGGCCCTGAGG No data
1104366961_1104366966 8 Left 1104366961 12:128186842-128186864 CCATCTCTTCTGTTGAAGAAGCC No data
Right 1104366966 12:128186873-128186895 CCTGAAACTGGAGACTGACCAGG No data
1104366961_1104366962 -4 Left 1104366961 12:128186842-128186864 CCATCTCTTCTGTTGAAGAAGCC No data
Right 1104366962 12:128186861-128186883 AGCCACATTCTCCCTGAAACTGG No data
1104366961_1104366967 9 Left 1104366961 12:128186842-128186864 CCATCTCTTCTGTTGAAGAAGCC No data
Right 1104366967 12:128186874-128186896 CTGAAACTGGAGACTGACCAGGG No data
1104366961_1104366969 18 Left 1104366961 12:128186842-128186864 CCATCTCTTCTGTTGAAGAAGCC No data
Right 1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104366961 Original CRISPR GGCTTCTTCAACAGAAGAGA TGG (reversed) Intergenic
No off target data available for this crispr