ID: 1104366963

View in Genome Browser
Species Human (GRCh38)
Location 12:128186863-128186885
Sequence CTCCAGTTTCAGGGAGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104366963_1104366968 -4 Left 1104366963 12:128186863-128186885 CCACATTCTCCCTGAAACTGGAG No data
Right 1104366968 12:128186882-128186904 GGAGACTGACCAGGGCCCTGAGG No data
1104366963_1104366969 -3 Left 1104366963 12:128186863-128186885 CCACATTCTCCCTGAAACTGGAG No data
Right 1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104366963 Original CRISPR CTCCAGTTTCAGGGAGAATG TGG (reversed) Intergenic
No off target data available for this crispr