ID: 1104366969

View in Genome Browser
Species Human (GRCh38)
Location 12:128186883-128186905
Sequence GAGACTGACCAGGGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104366963_1104366969 -3 Left 1104366963 12:128186863-128186885 CCACATTCTCCCTGAAACTGGAG No data
Right 1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG No data
1104366961_1104366969 18 Left 1104366961 12:128186842-128186864 CCATCTCTTCTGTTGAAGAAGCC No data
Right 1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104366969 Original CRISPR GAGACTGACCAGGGCCCTGA GGG Intergenic
No off target data available for this crispr