ID: 1104367172

View in Genome Browser
Species Human (GRCh38)
Location 12:128188335-128188357
Sequence GATCCCTTCCACAGAGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104367172_1104367176 27 Left 1104367172 12:128188335-128188357 CCAAAGTCTCTGTGGAAGGGATC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1104367176 12:128188385-128188407 AGTAGGTCCATGCAATGCTTAGG No data
1104367172_1104367175 10 Left 1104367172 12:128188335-128188357 CCAAAGTCTCTGTGGAAGGGATC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1104367175 12:128188368-128188390 ATAATTATTCTAGTATAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104367172 Original CRISPR GATCCCTTCCACAGAGACTT TGG (reversed) Intergenic
901139960 1:7022298-7022320 GATCCCTTCCCTCCAGACTTTGG + Intronic
902143139 1:14373698-14373720 GATGCATTCCACAGAGTCCTAGG + Intergenic
902408331 1:16198674-16198696 GATCTCTTCCACATAGGCCTGGG + Exonic
902941826 1:19805638-19805660 TATCTCTTACACAGAGGCTTGGG + Intergenic
904649719 1:31995831-31995853 GACCCCTACCTCAGATACTTGGG + Intergenic
905372683 1:37492911-37492933 GATCCCATCCCTAGAGACTGGGG - Exonic
907279055 1:53333291-53333313 GTTCCCTTCCACATAGAATAGGG - Intergenic
910421767 1:87071850-87071872 GATAGCTTGCACAAAGACTTGGG + Intronic
910502328 1:87907067-87907089 GATTTCTTCCACAGAGCCTCTGG - Intergenic
916597133 1:166254642-166254664 CATCCCTTCCCCATTGACTTTGG - Intergenic
917740167 1:177953934-177953956 GATCACTTCCTTAGAGCCTTGGG - Intronic
919489771 1:198192480-198192502 GGTCCCTACCAAAGAAACTTTGG - Intronic
920239229 1:204532069-204532091 TATGCCTTACAGAGAGACTTGGG + Intronic
921089010 1:211825075-211825097 GCTCCCTTCCAGCCAGACTTTGG + Intronic
924460517 1:244254636-244254658 TGTCCCTTCCCCAGCGACTTGGG - Intergenic
1063960211 10:11300435-11300457 GGTACCTTCCCCAGAGACATTGG - Intronic
1065538872 10:26741154-26741176 GATCCTGTTCCCAGAGACTTTGG - Intronic
1074995177 10:118750656-118750678 TATCTGGTCCACAGAGACTTCGG + Intronic
1075567169 10:123513101-123513123 GATCCCTTCATCAGAGCCTCTGG - Intergenic
1078884045 11:15482287-15482309 GATACCTACCACAGAGGCTTGGG - Intergenic
1080807643 11:35669431-35669453 GATCCTTTCCATATAGACTTGGG - Intronic
1083596108 11:63918910-63918932 GATCCCTGCTAGAGAGACTGGGG - Intergenic
1084275305 11:68048264-68048286 AATCACTTCCACAGAGGGTTGGG - Intronic
1085958148 11:81426598-81426620 TATTCCTTCCTCAGAGATTTTGG - Intergenic
1088351237 11:108890712-108890734 GTTCTATTCCACAGAGAATTGGG + Intronic
1090275228 11:125414141-125414163 GGTCACTTCCACCCAGACTTGGG + Intronic
1099109445 12:78539039-78539061 GTTCCCTACCACATAAACTTAGG - Intergenic
1101286552 12:103319406-103319428 GATCCCTTCAACAAAGACTAGGG - Intronic
1101300149 12:103471168-103471190 GATCCAATCCACAGAGATTCTGG - Intronic
1101799980 12:108013327-108013349 GGTCCCATCCCCAGAGACTTTGG + Intergenic
1102417754 12:112779289-112779311 GACTCCTCCGACAGAGACTTTGG - Intronic
1102928373 12:116843757-116843779 AATCCCTTCCTCAGAGAAATGGG - Intronic
1104367172 12:128188335-128188357 GATCCCTTCCACAGAGACTTTGG - Intergenic
1104778212 12:131403630-131403652 GACCCCTGACACAGAGATTTGGG - Intergenic
1105702510 13:22943901-22943923 GATCCCTGCCACAGTGATTCAGG + Intergenic
1105855138 13:24365682-24365704 GATCCCTGCCACAGTGATTCAGG + Intergenic
1108829176 13:54455398-54455420 GATCCCTGCCACAGGGGTTTGGG - Intergenic
1114237227 14:20833943-20833965 AATTCCTACAACAGAGACTTGGG + Intergenic
1115309997 14:31969221-31969243 GATGCCTTCTATAAAGACTTGGG + Intergenic
1119950497 14:78739427-78739449 GTTGCCCTCCACAGAGCCTTGGG + Intronic
1120277068 14:82389355-82389377 GATTCCTTCCAGAGTGACTTGGG + Intergenic
1121220000 14:92278014-92278036 GAGCCCTTCCCCAGACACTTTGG - Intergenic
1124577594 15:30923551-30923573 GATCCCTTCCCTGGAGACTGAGG - Intronic
1124913176 15:33943207-33943229 TATCCATTCAACAGACACTTGGG - Intronic
1128139705 15:65290238-65290260 GATCCCTTCCATAGAGTACTGGG - Intronic
1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG + Intronic
1130868426 15:87951639-87951661 GAGTCCTTCCACAGAGACTTGGG + Intronic
1132084914 15:98900389-98900411 AATTCCTTCCAAAGAGAATTTGG + Intronic
1132799668 16:1745780-1745802 GATTCCTTCTAGAGAAACTTAGG + Intronic
1133852067 16:9514653-9514675 TATCACTTTCACAGAGACTATGG - Intergenic
1135760527 16:25134455-25134477 GATCCCTGCCCCAGAGCCTCTGG - Intronic
1138048015 16:53746259-53746281 TTTCCCTGCCACAGTGACTTTGG + Intronic
1138447933 16:57076480-57076502 GATCCCTGACACAGAGGCTGAGG + Intronic
1138461426 16:57150312-57150334 AATCCCTTCCACGGAGGCCTGGG + Intergenic
1139639872 16:68283617-68283639 CATGTCTGCCACAGAGACTTTGG + Intronic
1141286557 16:82678098-82678120 GATACCTTCCATGGGGACTTGGG - Intronic
1141950401 16:87335762-87335784 GATCCCCTCCATGGTGACTTGGG - Intronic
1142877073 17:2857656-2857678 GAAGCCTTCCTCAGAGACTGCGG + Intronic
1143382333 17:6504126-6504148 GAAACCTTCCTCAGAGACCTGGG - Intronic
1143780275 17:9225607-9225629 TGTCCCTCCCACACAGACTTGGG + Intronic
1144423124 17:15115930-15115952 GGTCACATCCACAGATACTTGGG + Intergenic
1147047934 17:37768554-37768576 GATGCTCTCCACAGAGGCTTGGG + Intergenic
1148987734 17:51638307-51638329 GCTATCTTCCTCAGAGACTTTGG - Intronic
1150600287 17:66645423-66645445 GATCCATTCCGCAGAGGCTGGGG - Exonic
1152513970 17:80811321-80811343 GATCCCCTCCACAGACACAGAGG - Intronic
1156879320 18:42057885-42057907 AAACTCTTCCACATAGACTTTGG + Exonic
1159952781 18:74496863-74496885 GATCCCTTTCCCGGAGACCTGGG + Intronic
1160062526 18:75545830-75545852 GATCACTTCCAAAGAGACATTGG - Intergenic
1160286582 18:77548904-77548926 GAGTCCCTCCACAGAGGCTTTGG - Intergenic
1166071086 19:40388455-40388477 CATTCCTTCCACAGAGACAGTGG + Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167846241 19:52167105-52167127 TATCCGTCCCACAGAGACTGCGG - Intronic
925145639 2:1581441-1581463 GATCCCTCCCACAGAGAAGGGGG + Intergenic
925212304 2:2060204-2060226 GGTCCCTTTCACAGGAACTTAGG + Intronic
931158953 2:59666943-59666965 GATCCTTTCCTCACAGCCTTCGG - Intergenic
936476431 2:112843961-112843983 GAGGCCTTCCACACACACTTGGG + Intergenic
936911885 2:117602090-117602112 GAACTCTTCCACAGAGTTTTAGG + Intergenic
938957640 2:136314288-136314310 GATCTCTACCACAGAAGCTTGGG + Intergenic
939957348 2:148538131-148538153 GCTCCCTGCCACAGGGACTTTGG - Intergenic
942171916 2:173297696-173297718 GGTGGCTTCCACAGAGGCTTTGG + Intergenic
943566136 2:189519233-189519255 GATCCCTCACACAGAGGGTTAGG - Intergenic
945718203 2:213384587-213384609 CATTCCTTCCCCAGAGGCTTAGG - Intronic
946313944 2:218897474-218897496 GATCCCTTCCCCGGAAACTGGGG - Intronic
948935909 2:241164526-241164548 GATCCCTTCGACTGATACTGAGG + Intronic
1169196481 20:3685609-3685631 AAACCCTTTCTCAGAGACTTCGG - Intergenic
1169440906 20:5633112-5633134 GACCCGTTCCACACTGACTTTGG - Intergenic
1170816124 20:19715963-19715985 GATCCCTTCCACAGAACCCTTGG + Intronic
1173413854 20:42838706-42838728 GATACCCTCCACAGAGAAGTGGG - Intronic
1173808989 20:45944920-45944942 GATGCCTTCCACGGAGTCCTTGG - Exonic
1174037512 20:47677315-47677337 CACCCCTTCCCCAGAGACTTGGG + Intronic
1182462898 22:30495009-30495031 GATCCTGGCCAGAGAGACTTGGG + Intronic
1184673688 22:46028700-46028722 GCTCACTTCCCCAGAGGCTTGGG - Intergenic
952821760 3:37492060-37492082 GATCCCTGCCACACACACTTTGG - Intronic
953107827 3:39902546-39902568 CATCCATTCCACAGAGGTTTAGG - Intronic
955665416 3:61344694-61344716 GATCCTTTCCTCAGGGACTTGGG + Intergenic
955836326 3:63059268-63059290 GAGCCCTTCCACATGGCCTTGGG - Intergenic
956014411 3:64866504-64866526 GAATCCTTTCACTGAGACTTAGG - Intergenic
960032226 3:113065813-113065835 GAGCCTTTTCACAGAGTCTTTGG + Intergenic
967875607 3:194266491-194266513 CCTCCCTTCCACACATACTTCGG - Intergenic
969867525 4:10085405-10085427 CATCTTTTCCACAGAGACGTGGG + Intronic
970031724 4:11683974-11683996 CATCCCTTCCTCAGAAAATTTGG + Intergenic
972586335 4:40440041-40440063 AATCACTTCCACAGAGCCCTTGG - Intronic
972650736 4:41015380-41015402 TTTGCCCTCCACAGAGACTTTGG + Intronic
972869762 4:43283078-43283100 AAGCCCTTCCAGAGAGATTTGGG - Intergenic
974950434 4:68578963-68578985 GATTCCCACAACAGAGACTTGGG - Intronic
974958817 4:68674482-68674504 GATTCCCACAACAGAGACTTGGG - Intergenic
978264014 4:106800542-106800564 GATCCCTTTCATAGATAATTAGG - Intergenic
980031608 4:127838277-127838299 GATCACTTCCACAGACATTTAGG - Exonic
981181705 4:141753460-141753482 GATACCATCCAGAGAGACATGGG + Intergenic
982958579 4:161805543-161805565 GATTCCTTCCTCAGACAATTGGG + Intronic
992094933 5:73354014-73354036 GATTACTTCCACACAGACATTGG - Intergenic
993251505 5:85530768-85530790 AATCCCTTCCAAAGTTACTTGGG + Intergenic
994952536 5:106482846-106482868 GACCCCACCCTCAGAGACTTAGG + Intergenic
998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG + Intergenic
1001392908 5:171394801-171394823 AATCCCTTCCAGAAAGGCTTTGG + Intronic
1003038901 6:2669376-2669398 GAGTCCTTCCACACAGACATGGG - Intronic
1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG + Intergenic
1005249567 6:23929104-23929126 CATCCCCTCCTCAGAGACTGTGG + Intergenic
1007046730 6:38783220-38783242 CATCCCTTCCACATAATCTTAGG + Intronic
1007789747 6:44302212-44302234 GGTCCCTACCTCAGAGACTATGG - Intronic
1021972735 7:25981453-25981475 GATGCGTTCCAGAGATACTTAGG + Intergenic
1022520582 7:31004421-31004443 GACCCCTCCCAGAGAGACTTAGG + Intergenic
1028902974 7:96121844-96121866 GCTCCCTTCCACAGAGCTTTTGG + Exonic
1029931372 7:104374707-104374729 GATGCCAACCACAGAGAGTTTGG - Intronic
1030205563 7:106949369-106949391 GGTCCATTCCACAGATACTTAGG - Intergenic
1030566712 7:111166710-111166732 GAATTCTTCCCCAGAGACTTTGG - Intronic
1031507193 7:122599462-122599484 GATTCCTTAGCCAGAGACTTGGG - Intronic
1039831601 8:41219674-41219696 GAACCCTTCACCAGAGATTTTGG - Intergenic
1040747477 8:50663045-50663067 GAGCCCTTTCACAGTCACTTAGG - Intronic
1041104584 8:54428705-54428727 AATCCCTTCTTCAGAGCCTTTGG - Intergenic
1041357480 8:57015494-57015516 GATCCCTTCCATTGAGATTAAGG + Intergenic
1046450361 8:114382707-114382729 GAGCCTTTTCACAGAGGCTTAGG + Intergenic
1046751645 8:117933119-117933141 GACCTCTTCAAGAGAGACTTTGG - Intronic
1048267566 8:133000960-133000982 GATCCTTCCCACAGGGACCTTGG - Intronic
1049386886 8:142347338-142347360 GATCCCTCCCTCTGTGACTTGGG - Intronic
1049400526 8:142424733-142424755 GATCCCTTCTTCAGATACTCCGG - Intergenic
1053476952 9:38389079-38389101 AATCCCTTCCAAAGGGACCTTGG + Intergenic
1057316061 9:93969244-93969266 GATTCCTGCCAAAGAGACTCTGG - Intergenic
1058904492 9:109470901-109470923 GTTACCATCCACAGAGATTTTGG + Intronic
1061949142 9:133926480-133926502 GAGCCCTACCAGAGAGATTTGGG - Intronic
1186663252 X:11691304-11691326 ATTCCCTTCAACAAAGACTTGGG - Intergenic
1188302173 X:28518289-28518311 CAGCCCTCCCTCAGAGACTTGGG + Intergenic
1188434537 X:30146024-30146046 GGTCCCTTCCACACTGACTTTGG + Intergenic
1192249486 X:69399554-69399576 TCTGCCTTCCACAGAGTCTTAGG + Intergenic
1193689217 X:84619962-84619984 TTTCCCTTCCCCAGAGCCTTAGG + Intergenic
1202168137 Y:22014150-22014172 GATGCCTTTCAAGGAGACTTGGG + Intergenic
1202223224 Y:22572218-22572240 GATGCCTTTCAAGGAGACTTGGG - Intergenic
1202319891 Y:23623442-23623464 GATGCCTTTCAAGGAGACTTGGG + Intergenic
1202550877 Y:26046614-26046636 GATGCCTTTCAAGGAGACTTGGG - Intergenic