ID: 1104372225

View in Genome Browser
Species Human (GRCh38)
Location 12:128234145-128234167
Sequence GGAGAGATCTCATGAAGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104372225_1104372227 -10 Left 1104372225 12:128234145-128234167 CCGAAGCTTCATGAGATCTCTCC No data
Right 1104372227 12:128234158-128234180 AGATCTCTCCTTGGTTGTGCAGG No data
1104372225_1104372231 9 Left 1104372225 12:128234145-128234167 CCGAAGCTTCATGAGATCTCTCC No data
Right 1104372231 12:128234177-128234199 CAGGGACGAGTGGCCGACTCTGG No data
1104372225_1104372232 17 Left 1104372225 12:128234145-128234167 CCGAAGCTTCATGAGATCTCTCC No data
Right 1104372232 12:128234185-128234207 AGTGGCCGACTCTGGAGCCCAGG No data
1104372225_1104372230 -1 Left 1104372225 12:128234145-128234167 CCGAAGCTTCATGAGATCTCTCC No data
Right 1104372230 12:128234167-128234189 CTTGGTTGTGCAGGGACGAGTGG No data
1104372225_1104372228 -9 Left 1104372225 12:128234145-128234167 CCGAAGCTTCATGAGATCTCTCC No data
Right 1104372228 12:128234159-128234181 GATCTCTCCTTGGTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104372225 Original CRISPR GGAGAGATCTCATGAAGCTT CGG (reversed) Intergenic