ID: 1104372230

View in Genome Browser
Species Human (GRCh38)
Location 12:128234167-128234189
Sequence CTTGGTTGTGCAGGGACGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104372223_1104372230 10 Left 1104372223 12:128234134-128234156 CCCAGACTGTGCCGAAGCTTCAT No data
Right 1104372230 12:128234167-128234189 CTTGGTTGTGCAGGGACGAGTGG No data
1104372225_1104372230 -1 Left 1104372225 12:128234145-128234167 CCGAAGCTTCATGAGATCTCTCC No data
Right 1104372230 12:128234167-128234189 CTTGGTTGTGCAGGGACGAGTGG No data
1104372224_1104372230 9 Left 1104372224 12:128234135-128234157 CCAGACTGTGCCGAAGCTTCATG No data
Right 1104372230 12:128234167-128234189 CTTGGTTGTGCAGGGACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104372230 Original CRISPR CTTGGTTGTGCAGGGACGAG TGG Intergenic
No off target data available for this crispr