ID: 1104374273

View in Genome Browser
Species Human (GRCh38)
Location 12:128250224-128250246
Sequence CATGAAATCAAACAGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374273_1104374278 8 Left 1104374273 12:128250224-128250246 CCCTGGGACTGTTTGATTTCATG No data
Right 1104374278 12:128250255-128250277 CCAGGAGCTTCCAGCACTCTTGG No data
1104374273_1104374281 30 Left 1104374273 12:128250224-128250246 CCCTGGGACTGTTTGATTTCATG No data
Right 1104374281 12:128250277-128250299 GCTGCAGCCTCCTGGAGAACAGG No data
1104374273_1104374280 22 Left 1104374273 12:128250224-128250246 CCCTGGGACTGTTTGATTTCATG No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374273_1104374275 -10 Left 1104374273 12:128250224-128250246 CCCTGGGACTGTTTGATTTCATG No data
Right 1104374275 12:128250237-128250259 TGATTTCATGATCTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374273 Original CRISPR CATGAAATCAAACAGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr