ID: 1104374276

View in Genome Browser
Species Human (GRCh38)
Location 12:128250254-128250276
Sequence CAAGAGTGCTGGAAGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374276_1104374285 28 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374285 12:128250305-128250327 TAAGTGAGTAAAGCTGTTGCAGG No data
1104374276_1104374282 3 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374282 12:128250280-128250302 GCAGCCTCCTGGAGAACAGGTGG No data
1104374276_1104374280 -8 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374276_1104374286 29 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374276_1104374281 0 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374281 12:128250277-128250299 GCTGCAGCCTCCTGGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374276 Original CRISPR CAAGAGTGCTGGAAGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr