ID: 1104374279

View in Genome Browser
Species Human (GRCh38)
Location 12:128250265-128250287
Sequence GAGGCTGCAGCCAAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374279_1104374285 17 Left 1104374279 12:128250265-128250287 CCAGCACTCTTGGCTGCAGCCTC No data
Right 1104374285 12:128250305-128250327 TAAGTGAGTAAAGCTGTTGCAGG No data
1104374279_1104374286 18 Left 1104374279 12:128250265-128250287 CCAGCACTCTTGGCTGCAGCCTC No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374279_1104374282 -8 Left 1104374279 12:128250265-128250287 CCAGCACTCTTGGCTGCAGCCTC No data
Right 1104374282 12:128250280-128250302 GCAGCCTCCTGGAGAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374279 Original CRISPR GAGGCTGCAGCCAAGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr