ID: 1104374280

View in Genome Browser
Species Human (GRCh38)
Location 12:128250269-128250291
Sequence CACTCTTGGCTGCAGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374274_1104374280 21 Left 1104374274 12:128250225-128250247 CCTGGGACTGTTTGATTTCATGA No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374271_1104374280 26 Left 1104374271 12:128250220-128250242 CCCTCCCTGGGACTGTTTGATTT No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374273_1104374280 22 Left 1104374273 12:128250224-128250246 CCCTGGGACTGTTTGATTTCATG No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374276_1104374280 -8 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374277_1104374280 -9 Left 1104374277 12:128250255-128250277 CCAGGAGCTTCCAGCACTCTTGG No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data
1104374272_1104374280 25 Left 1104374272 12:128250221-128250243 CCTCCCTGGGACTGTTTGATTTC No data
Right 1104374280 12:128250269-128250291 CACTCTTGGCTGCAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374280 Original CRISPR CACTCTTGGCTGCAGCCTCC TGG Intergenic
No off target data available for this crispr