ID: 1104374281

View in Genome Browser
Species Human (GRCh38)
Location 12:128250277-128250299
Sequence GCTGCAGCCTCCTGGAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374276_1104374281 0 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374281 12:128250277-128250299 GCTGCAGCCTCCTGGAGAACAGG No data
1104374277_1104374281 -1 Left 1104374277 12:128250255-128250277 CCAGGAGCTTCCAGCACTCTTGG No data
Right 1104374281 12:128250277-128250299 GCTGCAGCCTCCTGGAGAACAGG No data
1104374274_1104374281 29 Left 1104374274 12:128250225-128250247 CCTGGGACTGTTTGATTTCATGA No data
Right 1104374281 12:128250277-128250299 GCTGCAGCCTCCTGGAGAACAGG No data
1104374273_1104374281 30 Left 1104374273 12:128250224-128250246 CCCTGGGACTGTTTGATTTCATG No data
Right 1104374281 12:128250277-128250299 GCTGCAGCCTCCTGGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374281 Original CRISPR GCTGCAGCCTCCTGGAGAAC AGG Intergenic
No off target data available for this crispr