ID: 1104374283

View in Genome Browser
Species Human (GRCh38)
Location 12:128250284-128250306
Sequence TAGACCACCTGTTCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374283_1104374286 -1 Left 1104374283 12:128250284-128250306 CCTCCTGGAGAACAGGTGGTCTA No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374283_1104374285 -2 Left 1104374283 12:128250284-128250306 CCTCCTGGAGAACAGGTGGTCTA No data
Right 1104374285 12:128250305-128250327 TAAGTGAGTAAAGCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374283 Original CRISPR TAGACCACCTGTTCTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr