ID: 1104374286

View in Genome Browser
Species Human (GRCh38)
Location 12:128250306-128250328
Sequence AAGTGAGTAAAGCTGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374276_1104374286 29 Left 1104374276 12:128250254-128250276 CCCAGGAGCTTCCAGCACTCTTG No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374283_1104374286 -1 Left 1104374283 12:128250284-128250306 CCTCCTGGAGAACAGGTGGTCTA No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374277_1104374286 28 Left 1104374277 12:128250255-128250277 CCAGGAGCTTCCAGCACTCTTGG No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374279_1104374286 18 Left 1104374279 12:128250265-128250287 CCAGCACTCTTGGCTGCAGCCTC No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data
1104374284_1104374286 -4 Left 1104374284 12:128250287-128250309 CCTGGAGAACAGGTGGTCTAAGT No data
Right 1104374286 12:128250306-128250328 AAGTGAGTAAAGCTGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374286 Original CRISPR AAGTGAGTAAAGCTGTTGCA GGG Intergenic
No off target data available for this crispr