ID: 1104374287

View in Genome Browser
Species Human (GRCh38)
Location 12:128250339-128250361
Sequence TTTTATGTGCCAACTTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4490
Summary {0: 16, 1: 392, 2: 1005, 3: 1446, 4: 1631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374284_1104374287 29 Left 1104374284 12:128250287-128250309 CCTGGAGAACAGGTGGTCTAAGT No data
Right 1104374287 12:128250339-128250361 TTTTATGTGCCAACTTGACTTGG 0: 16
1: 392
2: 1005
3: 1446
4: 1631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374287 Original CRISPR TTTTATGTGCCAACTTGACT TGG Intergenic
Too many off-targets to display for this crispr