ID: 1104374987

View in Genome Browser
Species Human (GRCh38)
Location 12:128257748-128257770
Sequence TCTCATCCTTACAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104374981_1104374987 3 Left 1104374981 12:128257722-128257744 CCTTGTTATCTTCCATCTTTTTA No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data
1104374976_1104374987 22 Left 1104374976 12:128257703-128257725 CCTCCAAATCCTCACCAACCCTT No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data
1104374978_1104374987 13 Left 1104374978 12:128257712-128257734 CCTCACCAACCCTTGTTATCTTC No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data
1104374977_1104374987 19 Left 1104374977 12:128257706-128257728 CCAAATCCTCACCAACCCTTGTT No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data
1104374979_1104374987 8 Left 1104374979 12:128257717-128257739 CCAACCCTTGTTATCTTCCATCT No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data
1104374983_1104374987 -9 Left 1104374983 12:128257734-128257756 CCATCTTTTTAAGGTCTCATCCT No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data
1104374980_1104374987 4 Left 1104374980 12:128257721-128257743 CCCTTGTTATCTTCCATCTTTTT No data
Right 1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104374987 Original CRISPR TCTCATCCTTACAAGGTGGG AGG Intergenic
No off target data available for this crispr