ID: 1104375180

View in Genome Browser
Species Human (GRCh38)
Location 12:128259668-128259690
Sequence GAGTAAACAGCGCTCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104375180_1104375182 -7 Left 1104375180 12:128259668-128259690 CCACCAGGGAGCGCTGTTTACTC No data
Right 1104375182 12:128259684-128259706 TTTACTCTATAACCATTCCCAGG No data
1104375180_1104375186 9 Left 1104375180 12:128259668-128259690 CCACCAGGGAGCGCTGTTTACTC No data
Right 1104375186 12:128259700-128259722 TCCCAGGCTGCGTGTGGGTCTGG No data
1104375180_1104375183 3 Left 1104375180 12:128259668-128259690 CCACCAGGGAGCGCTGTTTACTC No data
Right 1104375183 12:128259694-128259716 AACCATTCCCAGGCTGCGTGTGG No data
1104375180_1104375184 4 Left 1104375180 12:128259668-128259690 CCACCAGGGAGCGCTGTTTACTC No data
Right 1104375184 12:128259695-128259717 ACCATTCCCAGGCTGCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104375180 Original CRISPR GAGTAAACAGCGCTCCCTGG TGG (reversed) Intergenic