ID: 1104377789

View in Genome Browser
Species Human (GRCh38)
Location 12:128280097-128280119
Sequence CTACATACATGAAAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104377784_1104377789 -4 Left 1104377784 12:128280078-128280100 CCAAGATTCATGCTGCCTGCTAC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1104377789 12:128280097-128280119 CTACATACATGAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1104377783_1104377789 -3 Left 1104377783 12:128280077-128280099 CCCAAGATTCATGCTGCCTGCTA 0: 1
1: 0
2: 5
3: 11
4: 128
Right 1104377789 12:128280097-128280119 CTACATACATGAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1104377782_1104377789 19 Left 1104377782 12:128280055-128280077 CCAGTCTCTTGAATCTTGATAGC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1104377789 12:128280097-128280119 CTACATACATGAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104377789 Original CRISPR CTACATACATGAAAATGGGG AGG Intronic
902107315 1:14048563-14048585 CTAAAAACATGAAAATTGGCTGG - Intergenic
902392474 1:16114672-16114694 CTACATACATGCACATGCGAAGG - Intergenic
902910299 1:19591252-19591274 ACACATACATTAAAAAGGGGAGG + Intergenic
905891786 1:41522548-41522570 CTACACCCCTGGAAATGGGGAGG + Intronic
908118878 1:60966988-60967010 AAACATACTTGAAAATGTGGAGG - Intronic
909284219 1:73794310-73794332 AAACATGCATGAAAAAGGGGTGG - Intergenic
910007707 1:82418859-82418881 GTGCATACATGAAAACAGGGAGG + Intergenic
910454577 1:87383702-87383724 TTAAATACATGAAAAGGGGGAGG + Intergenic
911331675 1:96531738-96531760 CTATAAAAATAAAAATGGGGAGG + Intergenic
911422455 1:97661304-97661326 ATACACACAAGAAAATGAGGGGG - Intronic
914664702 1:149823335-149823357 CTACACTCATGAACATGGGAGGG + Intergenic
914671063 1:149870483-149870505 CTACACTCATGAACATGGGAGGG - Intronic
915755886 1:158259247-158259269 GTACATGCAGGAAAAGGGGGAGG - Intergenic
916217449 1:162409543-162409565 CTGCTTACATGTAAATGGGATGG - Intronic
916230705 1:162538516-162538538 ATATTTAAATGAAAATGGGGGGG + Intergenic
916236634 1:162595371-162595393 CTATATACATCTTAATGGGGTGG + Intronic
922050384 1:221983757-221983779 GAACATACATGAAAAAGGTGTGG + Intergenic
923018628 1:230146216-230146238 CGAGATACATGAAAAGGGAGGGG - Intronic
1064054798 10:12088319-12088341 CTACAAACATGAAAATTAGGTGG + Intronic
1065631577 10:27686222-27686244 GTCCATCCATGAAGATGGGGTGG - Intronic
1070095255 10:73331377-73331399 ATACATATATAAAAATTGGGGGG + Intronic
1073752783 10:106548796-106548818 CTTCAAACATTAAAATGGGAAGG + Intergenic
1074962705 10:118462652-118462674 TTACATATATGCAAATGGGCTGG + Intergenic
1077726753 11:4682606-4682628 CTACATACATGGAAAGGAGGGGG + Exonic
1078960327 11:16259835-16259857 TTACACACATAAAAATGTGGTGG + Intronic
1079330386 11:19528153-19528175 TTAAAAACATGAAACTGGGGTGG - Intronic
1080110335 11:28559643-28559665 GTCCCTAAATGAAAATGGGGTGG - Intergenic
1082664394 11:55956737-55956759 GTATATACCTGAAAAGGGGGCGG + Intergenic
1082855964 11:57806892-57806914 CTACAAAAATGAAAAAGGGCGGG - Intronic
1084015708 11:66379606-66379628 CTATATATAAGAATATGGGGCGG + Intergenic
1085186496 11:74580192-74580214 TTAAATACATGGAAATGGAGAGG - Intronic
1085486364 11:76866887-76866909 CTACATAAAGGGAAATGGAGGGG + Intronic
1085553151 11:77394002-77394024 CTAAATAAATAAAGATGGGGGGG + Intronic
1086484584 11:87285208-87285230 CTCTATACTTGAAAATGGGTTGG + Intronic
1090330525 11:125927981-125928003 TTCCACAAATGAAAATGGGGTGG + Intergenic
1093706428 12:22279610-22279632 ATGCAGAGATGAAAATGGGGTGG - Intronic
1095978267 12:47954621-47954643 CTAGAAACAGGAAAATGAGGAGG - Intergenic
1096863269 12:54545744-54545766 CTACATTAATGAAAATGCTGAGG - Exonic
1097830570 12:64220658-64220680 TTATATATGTGAAAATGGGGTGG - Intronic
1099228468 12:79996178-79996200 CTACATACATGGAAAGGGAGAGG - Intergenic
1099716927 12:86307503-86307525 CTACTTAGATGCAAATGGGGTGG + Intronic
1100513922 12:95307402-95307424 ATAAATAAATGAAAATGGGCTGG + Intergenic
1102919894 12:116783990-116784012 CTACATCTGTGAAAATGGGATGG - Intronic
1103483851 12:121269349-121269371 TTACAGATAGGAAAATGGGGAGG - Intronic
1104377789 12:128280097-128280119 CTACATACATGAAAATGGGGAGG + Intronic
1107402094 13:40079356-40079378 TGACATAGATGTAAATGGGGAGG - Intergenic
1110036079 13:70686405-70686427 TTAAAAACATAAAAATGGGGAGG + Intergenic
1111112937 13:83738807-83738829 CCACATACATGTATTTGGGGAGG - Intergenic
1111894457 13:94124007-94124029 ATACACTAATGAAAATGGGGAGG + Intronic
1113267399 13:108634511-108634533 CTGCAAACAAGGAAATGGGGTGG - Intronic
1113530067 13:111017990-111018012 CGAAATACATGAAAGTGGGAAGG - Intergenic
1118134434 14:63006459-63006481 CCCCATACATAAAACTGGGGGGG + Exonic
1120053087 14:79891394-79891416 CTCCATGCCTGGAAATGGGGAGG - Intergenic
1120581776 14:86259856-86259878 CTATAAACAGGAAAATGGGTAGG - Intergenic
1121771878 14:96552871-96552893 CTAAATACATGAATTTGGAGGGG - Intronic
1122783813 14:104154864-104154886 CTCCATACATGGAGATTGGGTGG + Intronic
1123194497 14:106603575-106603597 GTACAGACAGGAAAATTGGGAGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125160428 15:36637054-36637076 CTACAGTCATCAAAATGGTGTGG + Intronic
1126232365 15:46342083-46342105 TTACATACATGAGAATGCGGAGG + Intergenic
1128708740 15:69856610-69856632 CCACAGGCATGAAAGTGGGGTGG - Intergenic
1129949119 15:79570563-79570585 CTTCATAGATGAAGATGTGGTGG + Intergenic
1130757579 15:86781797-86781819 CAAGATACATGTAAATGAGGTGG - Intronic
1130972828 15:88747435-88747457 AGACATACAGGAAGATGGGGGGG - Intergenic
1131558800 15:93421947-93421969 TTACCTAGTTGAAAATGGGGAGG - Intergenic
1132257674 15:100391528-100391550 CTTTATACATAAAATTGGGGGGG - Intergenic
1132825931 16:1905536-1905558 CTACATAAATTAAAATCTGGAGG + Intergenic
1133714789 16:8437280-8437302 CTAGATTCATGAAAATGAGCAGG - Intergenic
1133949297 16:10377088-10377110 CTAAAAACATGAAAATGAGCCGG - Intronic
1134177650 16:12021073-12021095 CTACAATCATGAAAATGGACTGG - Intronic
1137868503 16:51926801-51926823 CTAAATCCATGAATATGGGAAGG - Intergenic
1138748924 16:59395552-59395574 CTACATACATTAAAATTGCATGG + Intergenic
1140288121 16:73623717-73623739 CTTCCAAAATGAAAATGGGGAGG + Intergenic
1142341693 16:89527565-89527587 CTACAGACAGGAAAATGGAACGG + Intronic
1143702934 17:8675001-8675023 CTACTCAGATGGAAATGGGGCGG - Intergenic
1145221475 17:21093084-21093106 AAACATAGATGAAAAAGGGGTGG - Intergenic
1147985126 17:44301925-44301947 CTACATTCATCAAAATAGAGTGG + Intergenic
1148931832 17:51133167-51133189 TTTCATACATGAATATGTGGAGG - Intergenic
1153893208 18:9536965-9536987 CCAGAAACAAGAAAATGGGGTGG - Exonic
1154365656 18:13706337-13706359 CAACAGAAATGAAAATGGGGGGG + Intronic
1155607788 18:27627711-27627733 CTACCTATATGAAAAAGGGATGG - Intergenic
1157106812 18:44781547-44781569 ATACATAAATGAAAATGATGTGG - Intronic
925220345 2:2134473-2134495 CAACATAAATGAATTTGGGGAGG - Intronic
926155492 2:10451349-10451371 CTACCTTTCTGAAAATGGGGTGG + Intergenic
928576824 2:32663625-32663647 ATACATACATAAATAGGGGGTGG - Intronic
930200238 2:48545779-48545801 CCACATACATCACAAAGGGGTGG - Intronic
933284376 2:80369258-80369280 TTAGATATATGAAAATGGTGGGG - Intronic
933548245 2:83741485-83741507 AAAGATACCTGAAAATGGGGAGG - Intergenic
935402819 2:102678352-102678374 AGACATGCATGAAAAGGGGGGGG + Intronic
935487938 2:103681144-103681166 CTGCATATATCTAAATGGGGTGG - Intergenic
939047542 2:137267649-137267671 TTACAGATAAGAAAATGGGGGGG - Intronic
941665435 2:168240074-168240096 CTACATAGATGAAAAATGGAAGG + Intronic
942891623 2:180996633-180996655 CAAGATACCTGGAAATGGGGGGG - Intronic
943395462 2:187327907-187327929 TTATATACCTGAAAATGTGGAGG + Intergenic
945034201 2:205690229-205690251 CTACAGAAAGGAAAATGAGGAGG + Intronic
1168803796 20:661481-661503 CTACAGAGAGGAAAATGGAGTGG + Intronic
1170106904 20:12761334-12761356 CAACATAACTGAAAATGGGGTGG + Intergenic
1177443235 21:21155967-21155989 CCACATAGATGAAAATGAAGGGG - Intronic
1179241565 21:39597579-39597601 CTGCAGACCTTAAAATGGGGAGG + Exonic
1179342579 21:40526494-40526516 CTACACACCTGAAAAGGGGAAGG - Intronic
1179366139 21:40759871-40759893 CTCCACACATCAAAAGGGGGAGG + Intronic
1179543103 21:42096747-42096769 CTGCAAACAGGAAAGTGGGGCGG - Intronic
949286809 3:2416427-2416449 ATACAGAAATGAAAATTGGGAGG + Intronic
949683287 3:6540607-6540629 GTAAATCCATGAAGATGGGGAGG - Intergenic
950947079 3:16960250-16960272 CTCCATACAAGACAATGGAGTGG - Intronic
952034436 3:29182308-29182330 CTACATAACTGAAAATAGAGGGG - Intergenic
954470516 3:50690428-50690450 CTATATACTTCAAAATGGGCAGG - Intronic
954843408 3:53533247-53533269 CTATCAAAATGAAAATGGGGAGG - Intronic
962088021 3:132212203-132212225 CCAGAGACATGAAATTGGGGAGG + Intronic
963795502 3:149627316-149627338 CTACATGGCTGAAAATGGGGTGG - Intronic
966106969 3:176347634-176347656 CTACATGCTCTAAAATGGGGAGG - Intergenic
967144073 3:186591287-186591309 CTCCATAAATGAAAATGCGATGG - Intronic
967692650 3:192494798-192494820 CTACATACTTGAAAGTGCTGTGG + Intronic
967784489 3:193476263-193476285 CTCCATACATAAAAATGGACGGG - Intronic
970063221 4:12060102-12060124 CTCCATACATGACAATAGGTAGG + Intergenic
970485061 4:16516904-16516926 TTGCATACATGAATAAGGGGAGG - Intronic
971264740 4:25087837-25087859 CTACATACTTGGACCTGGGGTGG - Intergenic
972921081 4:43942643-43942665 CAACAAACATGAAAATGCTGGGG + Intergenic
973159262 4:46994564-46994586 ATACATAAATTAAAATGGAGGGG + Intronic
975036748 4:69694037-69694059 CTAAATACATGAAAATTAGCTGG - Intergenic
976709126 4:88050381-88050403 CTCCATACCAGAAAATTGGGAGG - Intronic
981503209 4:145474321-145474343 ATAGATACCTGAAAATGTGGAGG - Intergenic
982903892 4:161043653-161043675 GCACAGACATGAAAATGGGAAGG - Intergenic
985763475 5:1764090-1764112 CTTGATAGAAGAAAATGGGGAGG + Intergenic
988414268 5:30926228-30926250 TTACAAACATGAAAATTGTGAGG - Intergenic
989529834 5:42495081-42495103 CTCCATCAAAGAAAATGGGGGGG - Intronic
990837926 5:60042820-60042842 ATAAATCCATGAAGATGGGGAGG + Intronic
991110539 5:62895089-62895111 CTACAAACAAGAAAATGCTGAGG - Intergenic
995451686 5:112309271-112309293 CTACATACATCAAAATCTTGGGG - Intronic
999614480 5:153407495-153407517 GTACAGAAATGAAAAGGGGGTGG + Intergenic
1002972921 6:2042668-2042690 CTACATACATCAAAATTGTCTGG - Intronic
1003824482 6:9937769-9937791 CTCTAAACATGAAAATGGGGAGG - Intronic
1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG + Intergenic
1009471824 6:64035613-64035635 CTACATCCCTGAAAATGTGCAGG + Intronic
1009573890 6:65426878-65426900 TTACATACATGGAAATGTTGTGG + Intronic
1012030710 6:94058211-94058233 CTACATATAGGTAAATGGGTAGG - Intergenic
1015628535 6:135206770-135206792 CTACATACTTGCCAATTGGGAGG + Intronic
1015855794 6:137623152-137623174 TTTTATACATGAAAATGGCGAGG - Intergenic
1018022539 6:159775440-159775462 CTGGATACATGAATGTGGGGAGG + Intronic
1019138588 6:169928618-169928640 ATATATACATGACAATGGAGGGG + Intergenic
1021269764 7:18571840-18571862 CAACATACATGAAAATATGCGGG - Intronic
1022785934 7:33636515-33636537 CTAGTTACATGAAATTGGGCAGG + Intergenic
1022818807 7:33938664-33938686 CTACTCACATGGAAATGTGGTGG - Intronic
1023754412 7:43402499-43402521 CCACATATATGAAAATCTGGTGG - Intronic
1024492606 7:50002517-50002539 CTAAATACATGAGAATGAGCTGG - Intronic
1030274474 7:107705285-107705307 AGACATACATGATAATGAGGAGG - Intronic
1034003006 7:147437196-147437218 CTACATTTATGATAATGAGGTGG + Intronic
1035154194 7:156898819-156898841 AGTCATACATGTAAATGGGGGGG + Intergenic
1035547205 8:492017-492039 CTACATACAAGAAAAAGGTACGG + Intronic
1036101197 8:5787221-5787243 CTAGATACATAGAAATGGAGTGG - Intergenic
1037611760 8:20481816-20481838 CTCCACATATGAAATTGGGGTGG - Intergenic
1038007353 8:23443777-23443799 GTACATTGGTGAAAATGGGGAGG + Intronic
1038853988 8:31311059-31311081 CTACACTGATGAAAATGGTGTGG + Intergenic
1039803087 8:40976435-40976457 TTACATACAAGAAAATGAGAAGG + Intergenic
1040732469 8:50465516-50465538 CTACATACATGATACTGTGCAGG - Intronic
1041048170 8:53907016-53907038 CTAATGACATTAAAATGGGGTGG - Intronic
1045569575 8:103355101-103355123 CTATGTGCATGAATATGGGGTGG + Intergenic
1046122848 8:109866905-109866927 TTCCACACATGAAAATGTGGAGG + Intergenic
1051156764 9:14156715-14156737 TAACATAGATGAGAATGGGGTGG - Intronic
1060425901 9:123505415-123505437 CTACATGCCTCAAAATGTGGAGG - Intronic
1186472278 X:9831058-9831080 CTACACACAGGAGAGTGGGGAGG + Intronic
1186788579 X:12975325-12975347 CTAGATACTGGATAATGGGGTGG + Exonic
1186825310 X:13333728-13333750 CTACATATCTGAAAATAGGAAGG - Intergenic
1187088473 X:16067615-16067637 CTACTTACATAAAAGTGGGTTGG + Intergenic
1188829937 X:34883812-34883834 CTACATACATGGTAATGCAGTGG + Intergenic
1192130758 X:68547537-68547559 CTATATACATGCAAATGGAATGG + Intergenic
1192905033 X:75542339-75542361 AAAGATACATGAAAATGTGGAGG - Intergenic
1193442072 X:81554550-81554572 ATATATACATGAAAGTGGGATGG + Intergenic
1194721391 X:97344205-97344227 CTAAATACAAGATACTGGGGTGG - Intronic
1195495663 X:105530073-105530095 GTATATACATGAAAATGGAATGG + Intronic
1195577749 X:106469270-106469292 TTAAAAACAGGAAAATGGGGAGG + Intergenic
1195693287 X:107647060-107647082 CAACATATATGAATTTGGGGAGG - Intronic
1196320676 X:114335857-114335879 CTCCATACAGGAAAAAAGGGGGG + Intergenic
1199706642 X:150431926-150431948 GTATATACATGATAATGGGATGG + Intronic