ID: 1104381513

View in Genome Browser
Species Human (GRCh38)
Location 12:128311983-128312005
Sequence CTTTCAGCACAGCTGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104381513_1104381520 -7 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381520 12:128311999-128312021 CTGAAAGGGACCCCGGAGCGGGG 0: 1
1: 0
2: 1
3: 6
4: 110
1104381513_1104381526 16 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381526 12:128312022-128312044 CTGACTCGGTTTGCAAAGTCGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1104381513_1104381525 15 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381525 12:128312021-128312043 GCTGACTCGGTTTGCAAAGTCGG 0: 1
1: 0
2: 0
3: 3
4: 64
1104381513_1104381521 2 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381521 12:128312008-128312030 ACCCCGGAGCGGGGCTGACTCGG 0: 1
1: 0
2: 0
3: 7
4: 103
1104381513_1104381518 -9 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381518 12:128311997-128312019 TGCTGAAAGGGACCCCGGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 141
1104381513_1104381519 -8 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381519 12:128311998-128312020 GCTGAAAGGGACCCCGGAGCGGG 0: 1
1: 0
2: 0
3: 16
4: 146
1104381513_1104381527 19 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381527 12:128312025-128312047 ACTCGGTTTGCAAAGTCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 658
1104381513_1104381528 22 Left 1104381513 12:128311983-128312005 CCAACTTCCAGCTGTGCTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1104381528 12:128312028-128312050 CGGTTTGCAAAGTCGGGCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104381513 Original CRISPR CTTTCAGCACAGCTGGAAGT TGG (reversed) Intronic
905285997 1:36880770-36880792 CTTCCAACGCAGCTGGATGTGGG + Exonic
906796786 1:48702636-48702658 CATGCAGCACAACAGGAAGTAGG + Intronic
908283737 1:62570642-62570664 CTTTCAGTATAGTTTGAAGTTGG - Intronic
910015184 1:82514984-82515006 CTCTGAGCAAAGCAGGAAGTGGG + Intergenic
910582882 1:88847831-88847853 CTTTCAGCACCTCTGGACGTTGG - Intergenic
911185780 1:94903423-94903445 CTTTAAGCCCAGCTGGAAGTTGG + Exonic
911645231 1:100330607-100330629 CTTTCGGTAGAGCTGGAAGAAGG - Intergenic
912628451 1:111226306-111226328 CTTTCAGCAGATCAGGAAGAGGG - Intronic
912864109 1:113241731-113241753 CTTTCAGGACAGCTGAAAAGTGG - Intergenic
913197794 1:116472376-116472398 CCTTCAGCAGTGCTGCAAGTGGG - Intergenic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
916841099 1:168601732-168601754 CTTTCAGGTGGGCTGGAAGTGGG + Intergenic
917023323 1:170614073-170614095 CTCTCTTCAGAGCTGGAAGTCGG + Intergenic
918623059 1:186627104-186627126 CATGCTGCACAGCTGAAAGTGGG - Intergenic
918993084 1:191723750-191723772 GTTTGAGCACAGCTGGAGATGGG + Intergenic
919028691 1:192210628-192210650 CTTTCAGTACAATTTGAAGTTGG - Intergenic
920228853 1:204457116-204457138 TTTTCGTCACAGCTGGAAGAAGG + Intronic
921712005 1:218382182-218382204 CTTTGAGCACTGCAGGAGGTGGG - Intronic
922141380 1:222891326-222891348 CTTTCATCACAGCTATAGGTAGG - Intronic
922707512 1:227797073-227797095 CTTTCTGCCCAGCTGAAAATGGG + Intergenic
923097709 1:230788687-230788709 CTTAAAGCACAGCAGGAAGGTGG + Intronic
923387845 1:233483332-233483354 CTACCAGCACAGCTGCAATTGGG - Intergenic
923930227 1:238685982-238686004 CTTGCAGCACAGTTTGAAGTTGG - Intergenic
924326310 1:242897522-242897544 CTTGCAGTACAGTTTGAAGTTGG + Intergenic
1064093799 10:12407689-12407711 CTTGGACCACAGCTGGAAATGGG - Intronic
1065973436 10:30822837-30822859 CTATCAGCATGGCTGGACGTGGG + Intronic
1067878639 10:50025207-50025229 CTTGCAGCTCAGCTACAAGTCGG - Intergenic
1067893087 10:50152729-50152751 CTTGCAGCTCAGCTACAAGTCGG + Intergenic
1069632119 10:69903299-69903321 CCTTCAGCTCAGCTGGCAGGTGG - Intronic
1071788943 10:88933913-88933935 CTTTCAGGCCAAATGGAAGTTGG + Intronic
1072607410 10:96996382-96996404 CTTTCAACTCTGCTTGAAGTGGG + Intergenic
1074010234 10:109471158-109471180 ATTTCAGAACAGATGGATGTAGG - Intergenic
1079392113 11:20031574-20031596 CTTTCAGTATGGCTGGATGTGGG + Intronic
1079898696 11:26153865-26153887 ATTTCAAAACAGCTAGAAGTGGG + Intergenic
1080585317 11:33676395-33676417 CTTTGAGAACAGCTGGATTTGGG + Intergenic
1084218666 11:67664994-67665016 CTTTCAGGACAGCCGGTGGTGGG + Intronic
1085401820 11:76240056-76240078 CTTCCAGCCCAGCTCCAAGTTGG - Intergenic
1087690152 11:101311483-101311505 CTTACAGCATAGTTTGAAGTTGG + Intergenic
1088112454 11:106277900-106277922 CCCTCAGCACAGCTGGTACTTGG - Intergenic
1089734995 11:120544641-120544663 ATTTCAGCACAGCTGTTATTAGG + Intronic
1091334185 11:134754254-134754276 CTGTCATCAGAGCTGGACGTGGG + Intergenic
1093255548 12:16862744-16862766 GTTTATTCACAGCTGGAAGTAGG - Intergenic
1093755803 12:22850706-22850728 CTTTCAGCAGAGAAGGGAGTTGG + Intergenic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1095927346 12:47592117-47592139 CTTTCAGCACAGCTGTGCCTCGG + Intergenic
1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG + Intergenic
1100128115 12:91455501-91455523 CTTTCATGACAGTTGGAAATTGG - Intergenic
1100156946 12:91810765-91810787 CTTTCTGCACATCTCCAAGTTGG - Intergenic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1106507462 13:30383745-30383767 CTTTCAGAAAAGCAAGAAGTGGG - Intergenic
1106667227 13:31864515-31864537 CTTTCAACAAACCTTGAAGTAGG - Intergenic
1107920024 13:45196841-45196863 GAGTCAGGACAGCTGGAAGTGGG + Intronic
1108331311 13:49387376-49387398 GTTTCAGCAAAGCAGGCAGTGGG + Intronic
1108615986 13:52132553-52132575 ATTTAAGGACAGCTGGTAGTTGG + Intergenic
1110241000 13:73266663-73266685 CCTTCAGCACAGCTGAAATTGGG + Intergenic
1111770505 13:92590164-92590186 CTTTCACTACAGCAGGAAGTGGG - Intronic
1111770771 13:92592950-92592972 CTTTCACTACAGCAGGAAGTGGG + Intronic
1113346549 13:109483425-109483447 CTGCCAGGTCAGCTGGAAGTGGG - Intergenic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1114554040 14:23551338-23551360 CTTACACCTCAGCTGGAAGCAGG + Exonic
1114918680 14:27298212-27298234 TGTTCAGCACAGATAGAAGTTGG - Intergenic
1116659971 14:47697635-47697657 CTTACAGTACAGTTTGAAGTTGG - Intergenic
1117335629 14:54755065-54755087 CCTTCAGAAGAGCTGGATGTTGG + Intronic
1117766545 14:59089239-59089261 TGTTCAGACCAGCTGGAAGTAGG - Intergenic
1120755025 14:88234799-88234821 TTTTCAGCAGAGCTGGAAGAAGG + Intronic
1122530662 14:102424126-102424148 CATTTAGCCCAGGTGGAAGTAGG - Intronic
1123171442 14:106376713-106376735 CTTTCATCTCTCCTGGAAGTTGG - Intergenic
1124088909 15:26579277-26579299 CTGTGAGCAGAGCTGGAAGGTGG + Intronic
1124342902 15:28901467-28901489 CCTTCAGCACAGCTGGGATTTGG + Intronic
1125477720 15:40058695-40058717 CAGTCAGCAAAGCTGGGAGTCGG + Intergenic
1128253372 15:66179419-66179441 CATTCCGCCCAGCTGGAGGTTGG + Intronic
1129679562 15:77650591-77650613 CTTGCAGAACAGGAGGAAGTGGG - Intronic
1131044436 15:89302267-89302289 CTTTGGGCAAACCTGGAAGTAGG - Intronic
1131908101 15:97166096-97166118 GTGTCAGCACAGCTGGGAGTTGG - Intergenic
1135142744 16:19935707-19935729 CATTCAGCACAGCTCTCAGTTGG - Intergenic
1137629158 16:49930083-49930105 CCTTCAGCACAGCTGGACCAAGG - Intergenic
1137810335 16:51346562-51346584 CTTCCAGCTCAGCTGGGAGTAGG - Intergenic
1139931999 16:70535212-70535234 CTTTCAGCACAACTTGATGATGG - Intronic
1140208235 16:72950673-72950695 CTTGCAGTGCAGCTGGAAGTTGG + Exonic
1141684656 16:85563458-85563480 CTTCCAGCACAGCTGTAATTGGG - Intergenic
1142899188 17:3001921-3001943 CTAGCACCACAGCTGGAGGTGGG - Intronic
1144777084 17:17790230-17790252 CTCCCAGCAGAGCTGGCAGTGGG + Intronic
1144932916 17:18874666-18874688 TTCTCAGCAGAGCTGGAGGTGGG + Intronic
1145347468 17:22050034-22050056 CTTACAGCAGAGCTGGGATTAGG - Intergenic
1145774724 17:27519877-27519899 CATCCAGCCCAGCTGGGAGTGGG + Intronic
1146768269 17:35544022-35544044 CTTTCAGATCAGCTGGATTTTGG + Intergenic
1147165254 17:38589706-38589728 CCATCAGCAGAGCTGGAAGCTGG - Intronic
1147856222 17:43482511-43482533 CTTACAGCACAGCTGATATTTGG + Intergenic
1149538118 17:57448129-57448151 CTTTCAGCAAGGCTAGAAGGAGG - Intronic
1151649230 17:75456091-75456113 ATTTCAGCCGAGCTGGAAGCGGG + Intronic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1154005138 18:10520975-10520997 CTTCCAGCGCAGCAGGAAGCTGG - Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1157721379 18:49927485-49927507 CTTACAGTACAGTTTGAAGTTGG - Intronic
1157756004 18:50218395-50218417 AGTTCAGCACAGCTGGATATGGG + Intergenic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1158307234 18:56119516-56119538 CATCCACCACTGCTGGAAGTGGG + Intergenic
1159921138 18:74228277-74228299 CATTCAGCCCAGCTGCAGGTGGG + Intergenic
1160361857 18:78290142-78290164 CTGTCAGCTCCGCAGGAAGTGGG - Intergenic
1160364695 18:78314034-78314056 CTTCCATCACAGCTGCAAATTGG + Intergenic
1160628253 18:80228172-80228194 CTCTGAGCACAGCTGGAAAAGGG + Intronic
1162027059 19:7900397-7900419 CTTCCAGCACTGCCGGAAGCTGG + Exonic
1162081852 19:8222831-8222853 CTCACAGCACAGGTGGAAGACGG + Intronic
1163176654 19:15569029-15569051 CACTCAGAACACCTGGAAGTGGG + Intergenic
1163235049 19:16025114-16025136 CTTTCAGCGAAACTGGAACTAGG + Intergenic
1166872967 19:45882159-45882181 CTTTAAGAACAGCTGGTAGGTGG - Intergenic
925921648 2:8642453-8642475 CTTGCAGCACAGATGGTAGGAGG - Intergenic
926618623 2:15025369-15025391 CTTGCAGTACAGTTTGAAGTCGG + Intergenic
927149020 2:20185266-20185288 CTTCAGGCACAGCTGGAAGTGGG - Intergenic
927272823 2:21231735-21231757 TTTTGAGCATAGCTGGAATTGGG + Intergenic
929351866 2:40966114-40966136 CCTTCTGCAGATCTGGAAGTTGG - Intergenic
929538981 2:42805132-42805154 CCTACAGCACAGCTGCCAGTGGG - Intergenic
930421530 2:51159261-51159283 CTTTCAGCTCAGCTGGCAGCAGG + Intergenic
935491844 2:103730996-103731018 CTTGTAGCACAGTTTGAAGTTGG - Intergenic
937225102 2:120364155-120364177 CTTGCAGGACAGATGGGAGTTGG + Intergenic
940846759 2:158650694-158650716 CTTTCAGCGCAGTGGGAAGTGGG - Intronic
943471846 2:188304197-188304219 ATTTCAGCACAAGTGGGAGTTGG - Intronic
943831562 2:192470590-192470612 CTTTCAGAACATATGCAAGTAGG - Intergenic
943896005 2:193360494-193360516 CTGTCAGTACAGCTGGATGAGGG + Intergenic
944278093 2:197862522-197862544 ATTTCAGTACAGCTGGATGTAGG + Intronic
944659273 2:201907364-201907386 CCTTCACCCCAGCTGGAATTTGG + Intergenic
945574024 2:211507483-211507505 CTTATAGCATAGCTTGAAGTTGG - Intronic
946001620 2:216487045-216487067 GCTTCAGCACAGCTGGGACTGGG + Intergenic
946812198 2:223537837-223537859 ATTCCAGCACTGCTGGAAGGTGG + Intergenic
947329930 2:229017863-229017885 ATTTCAGCATAAGTGGAAGTTGG - Intronic
947792796 2:232877387-232877409 TGCTCAGCACAGCAGGAAGTGGG + Intronic
948167031 2:235870843-235870865 CTTTAAGTACAGCAGGAAGCAGG - Intronic
948556999 2:238819305-238819327 CTTACAGCATAGTTTGAAGTTGG - Intergenic
1169973636 20:11299021-11299043 CTTACATCACAGCAGGAGGTGGG + Intergenic
1174626526 20:51919576-51919598 CTTTCAGCACAGTTAAAAGTTGG + Intergenic
1175236324 20:57514789-57514811 CTTTCAGCACAGGTGGCCTTTGG - Intronic
1175678738 20:60968985-60969007 GATTCAGCACAGAAGGAAGTGGG - Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1177880691 21:26690404-26690426 CTTTCAGCTGTGCTGCAAGTAGG + Intergenic
1177929068 21:27257511-27257533 CTTGCAGGTCAGCTGGAAGCTGG - Intergenic
1177935665 21:27342608-27342630 CTTTCAGCAAAGGTTGAAATTGG - Intergenic
1178215639 21:30594557-30594579 CTTCCAGCATAGTTTGAAGTTGG + Intergenic
1180676865 22:17592452-17592474 CTTTCAGAAGAACTGGAGGTGGG + Exonic
1183521250 22:38297369-38297391 TTTTCAGCAAGGCTGGAAATGGG - Intronic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1184840070 22:47047475-47047497 CCTTCAGCACAGCTGGTTGCTGG + Intronic
1185039062 22:48495177-48495199 CTTCCAGCACTGCTCGAAGGAGG + Intronic
950381002 3:12614791-12614813 GTTTCTGAAAAGCTGGAAGTTGG - Intronic
950381067 3:12615694-12615716 ATTTGAGCACAGCTGGTGGTTGG - Intronic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
953864634 3:46573628-46573650 CTCTCAGAACAGCTGGAAGCTGG + Intronic
954145216 3:48631098-48631120 CTTTGAGAACAGCTGGGTGTTGG + Exonic
955277162 3:57557150-57557172 CTTTGGGCACAGCCGGGAGTTGG + Exonic
956634056 3:71345718-71345740 CTTTCAGCACTGCTGAGAGCAGG + Intronic
957418973 3:79943958-79943980 CTTTTAGTACAGTTTGAAGTCGG - Intergenic
959915626 3:111814051-111814073 CTTACAGCTCAGCTGCAATTGGG - Intronic
960866888 3:122210824-122210846 CTTGTAGCACAGTTTGAAGTTGG - Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961664296 3:128486597-128486619 CTCACAGGCCAGCTGGAAGTGGG + Intronic
962479484 3:135786066-135786088 ATTTCACCACAGCAAGAAGTGGG - Intergenic
963222920 3:142830933-142830955 CACTCAGCACAGCTGACAGTAGG - Intronic
964944538 3:162203959-162203981 ATTTAATCACAGCTGTAAGTAGG - Intergenic
966641363 3:182194456-182194478 CTTTAAGCACTGCAGGAAGGTGG + Intergenic
970971410 4:21988416-21988438 CATTCAGAACACCTGGAAGCAGG + Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
971660039 4:29401744-29401766 CTTTGAGGAAAGGTGGAAGTGGG - Intergenic
972377306 4:38484916-38484938 CTTGCAGTACAGTTTGAAGTTGG - Intergenic
975616931 4:76256217-76256239 CTCTCTGCACAGCCGGCAGTTGG + Exonic
979782377 4:124669258-124669280 CCTTCAGCTCAGCAGGAAATTGG - Exonic
987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG + Intronic
989355070 5:40534731-40534753 CTTATAGTACAGTTGGAAGTTGG + Intergenic
991575044 5:68093808-68093830 CTTTCAGGACAACTTGAATTTGG - Intergenic
991993712 5:72366505-72366527 CTGACAGCAAAGCAGGAAGTTGG - Intergenic
992024650 5:72658319-72658341 TTTCCAGCACAGCTGGGAGCTGG + Intergenic
993216504 5:85029922-85029944 CTTTCAGCTCAACTTTAAGTAGG - Intergenic
994592931 5:101794487-101794509 CTTGTAGCATAGCTTGAAGTTGG + Intergenic
994714996 5:103310510-103310532 CTTGTAGCATAGCTTGAAGTCGG + Intergenic
997791503 5:136766404-136766426 CATTCAACACTGCTGGAGGTTGG - Intergenic
997956845 5:138285511-138285533 GTTTCAGCAGAGCTGAAAGCTGG - Exonic
999901920 5:156094385-156094407 CTTTCTGCACAGCTAAGAGTTGG + Intronic
1001452404 5:171836731-171836753 CTTTCAGCTCAACTGAGAGTGGG + Intergenic
1001692591 5:173644046-173644068 GCTTCAGCAGAGCCGGAAGTTGG + Intergenic
1001932525 5:175683460-175683482 CTTGCAGGACAGCTGGTAGATGG - Exonic
1005111337 6:22285277-22285299 GGTTCATCACAGCTGGAAGCAGG + Intergenic
1005151911 6:22761421-22761443 CTTACAGCATAGTTTGAAGTCGG + Intergenic
1005416951 6:25610087-25610109 TTTTCAGGACAGGTGGAAGAAGG - Exonic
1008086339 6:47248721-47248743 CTTTCAGCAGTCCTGGAATTGGG + Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1011195675 6:84776810-84776832 GTTACAGCAGAGCAGGAAGTCGG - Intergenic
1012529559 6:100218466-100218488 TTTTCAGCAAAGCTAGGAGTGGG - Intergenic
1013878281 6:114861702-114861724 CCTTCAGGACACCTGAAAGTGGG - Intergenic
1015048572 6:128810647-128810669 CTTGCAGTATAGCTTGAAGTTGG + Intergenic
1015425627 6:133063154-133063176 CTGACAGCACAGTTGGCAGTTGG + Intergenic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1016558982 6:145373143-145373165 CTTGCTGCACAGCTGGAATAAGG + Intergenic
1016641827 6:146358530-146358552 CTCACAGCACAGCTGGAGCTGGG + Intronic
1018039429 6:159908989-159909011 TTTTCATCACACCTGGAAGGAGG + Exonic
1019311593 7:364448-364470 CTGTCACCACTGCTGGATGTTGG + Intergenic
1019398188 7:834635-834657 CTCCCCGCACAGCTGGAAGGTGG + Intronic
1019608930 7:1926208-1926230 CTTTCATCTCAGCTGAATGTTGG - Intronic
1020490297 7:8774309-8774331 CTTATAGTATAGCTGGAAGTAGG + Intergenic
1021351353 7:19597883-19597905 TTTACAGCACAGTTTGAAGTTGG + Intergenic
1023735630 7:43233826-43233848 AATGCAGCAAAGCTGGAAGTAGG + Intronic
1023875050 7:44282346-44282368 GTGACTGCACAGCTGGAAGTGGG - Intronic
1024285703 7:47755843-47755865 CTTTCAGCACATCAAGAACTGGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024710709 7:52011698-52011720 AATGCAGCACACCTGGAAGTGGG + Intergenic
1024895690 7:54259355-54259377 CATTCAGGACAACTGGAAGGAGG - Intergenic
1027923989 7:84435917-84435939 CTTACAGCACAGTTTAAAGTAGG - Intronic
1029111349 7:98214376-98214398 CCTTCAGCACAGCTCGGGGTGGG + Intergenic
1029422012 7:100476758-100476780 CTTACAGCAAAGCTGGAGGCAGG + Intronic
1032196842 7:129794349-129794371 CTTTCAGCCCAGCAGGCACTGGG + Intergenic
1036141500 8:6213170-6213192 GCTTCATCAGAGCTGGAAGTAGG - Intergenic
1036514800 8:9433967-9433989 CTCTCAGGAGAGCTGGAATTAGG - Intergenic
1036620400 8:10421449-10421471 CTGGCAGCACAGGTGGCAGTGGG - Intronic
1038889007 8:31697504-31697526 CTTTCAAGACAGCTGGGAGTTGG - Intronic
1041395005 8:57381159-57381181 ATTTCTGCACAGCTTGAAGTCGG + Intergenic
1043150434 8:76707822-76707844 CTTGCAGTGTAGCTGGAAGTTGG - Exonic
1043372394 8:79610526-79610548 CTTTTAGCACAGCTGGACTTAGG - Intergenic
1043988259 8:86719733-86719755 CTTATAGCATAGCTTGAAGTTGG - Intronic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1047585169 8:126263532-126263554 TCTTCAGCACACATGGAAGTAGG + Intergenic
1048866197 8:138763572-138763594 CTTGCAGCCCACCTGGAAGAAGG - Intronic
1050986254 9:12087008-12087030 CTTTGAGTACAGTTTGAAGTTGG + Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052532924 9:29710476-29710498 CTTATAGCAGAGCTTGAAGTTGG - Intergenic
1054746826 9:68862491-68862513 CTATAAGAAAAGCTGGAAGTGGG + Intronic
1054970852 9:71084865-71084887 CTTGCAGCATAGTTTGAAGTTGG - Intronic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1058501458 9:105622863-105622885 CTTTCAGCACAGTGGTAAATTGG + Intronic
1060199861 9:121646120-121646142 CTCTCAACACAGGCGGAAGTGGG - Intronic
1061889850 9:133612950-133612972 CTTGCAGCACAGCTGGCACCCGG + Intergenic
1189186033 X:39056092-39056114 GTTGCAGCATAGCTGGAAGGGGG - Intergenic
1190151996 X:47956865-47956887 CTTTCAGCACAGCTCGTACTGGG + Intronic
1190160662 X:48029284-48029306 CTTTCAGCACAGCTCGTACTGGG - Intronic
1190512390 X:51186202-51186224 CAGTCAGCACATTTGGAAGTAGG + Intergenic
1194619003 X:96145340-96145362 CTTGTAGCATAGCTTGAAGTTGG - Intergenic
1194801203 X:98275593-98275615 CTTACAGTATAGCTTGAAGTTGG - Intergenic
1195150036 X:102057991-102058013 CTTTTAGTACAGTTTGAAGTTGG + Intergenic
1196208808 X:112971809-112971831 TGTTCAGCACAGCTGGGAATAGG + Intergenic
1197130718 X:123002726-123002748 ATTTGAGCAAAGCTGGAAGGAGG - Intergenic
1197417725 X:126195588-126195610 CTTACAGTATAGCTTGAAGTTGG + Intergenic
1198986297 X:142457975-142457997 CTTTTAGCACAGCTCTAATTCGG - Intergenic
1201223749 Y:11796076-11796098 CTTGCAGTACAGTTTGAAGTTGG + Intergenic