ID: 1104388532

View in Genome Browser
Species Human (GRCh38)
Location 12:128372066-128372088
Sequence GTGGTTGCCTGGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104388532_1104388538 30 Left 1104388532 12:128372066-128372088 CCATCCTCAGTCCAGGCAACCAC 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1104388538 12:128372119-128372141 TGCCATCTTGCCCCCATGAAGGG 0: 1
1: 1
2: 3
3: 19
4: 140
1104388532_1104388536 6 Left 1104388532 12:128372066-128372088 CCATCCTCAGTCCAGGCAACCAC 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1104388536 12:128372095-128372117 ACTTTGCTTCTCTCAATTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 206
1104388532_1104388537 29 Left 1104388532 12:128372066-128372088 CCATCCTCAGTCCAGGCAACCAC 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1104388537 12:128372118-128372140 CTGCCATCTTGCCCCCATGAAGG 0: 1
1: 2
2: 5
3: 44
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104388532 Original CRISPR GTGGTTGCCTGGACTGAGGA TGG (reversed) Intronic
900321119 1:2084580-2084602 GTCTCTGCCTGGACTGTGGATGG + Intronic
900346814 1:2214122-2214144 GTGGTGGCCTTGACTGGAGAGGG + Intergenic
900527707 1:3137177-3137199 CTGGAAGCCTGGGCTGAGGAGGG - Intronic
900687138 1:3955748-3955770 GTGGTTGACTGCAGTGGGGAAGG + Intergenic
900766126 1:4506832-4506854 GTGGTTGCCCGGGCTGGCGAGGG - Intergenic
901377163 1:8847775-8847797 CTGGGTGCCTGGTCTGGGGAAGG - Intergenic
902169398 1:14598468-14598490 GGGGTCGCCTGGACCGAGGCCGG - Intergenic
903031618 1:20467771-20467793 GTTATTGCCTGGGCTGAGGGTGG - Intergenic
904834031 1:33323529-33323551 GTGGGTCCCTGGGCTGGGGAAGG - Intergenic
905430008 1:37915168-37915190 GTTGCTGCTTGGGCTGAGGAAGG - Intronic
905716585 1:40156740-40156762 CTTGTTGCCTGGACTTAGGGTGG + Intergenic
905731307 1:40301087-40301109 ATGGTTTCCTGGACTGGGGATGG + Exonic
907090767 1:51723312-51723334 GTGGTTGCCAGGGATGAGGGAGG - Intronic
908309857 1:62869912-62869934 GTGGTTGCTAGGGCTGGGGACGG - Intergenic
908823176 1:68108542-68108564 GTGGGTGATTGGACTGAGGTGGG + Intronic
909407001 1:75302545-75302567 GTGAATGCCTGAACTGCGGATGG + Intronic
909504794 1:76376472-76376494 GTGGTTGCCAGGAGTAAGGAGGG - Intronic
910394070 1:86774332-86774354 GGGGTGGCCAGGACTGAAGAAGG + Intergenic
910499763 1:87876604-87876626 GTGGTTGCCAGGGATGGGGATGG - Intergenic
911774529 1:101791506-101791528 GTGGTTGCTAGGAGTTAGGAGGG + Intergenic
912494668 1:110083911-110083933 GTGGGTGCGGGGACTGCGGAGGG + Intergenic
913474270 1:119221842-119221864 GGGGTTGGGTGGAGTGAGGAGGG - Intergenic
914016465 1:143823969-143823991 GTGGTTGCCAGGTGTTAGGAGGG + Intergenic
914161318 1:145137032-145137054 GTGGTTGCCAGGTGTTAGGAGGG - Intergenic
914443198 1:147724813-147724835 GTGGTTACCAGGAGTGGGGAGGG - Intergenic
914655083 1:149732509-149732531 GTGGTTGCCAGGTGTTAGGAGGG + Intergenic
914941761 1:152029281-152029303 GTGGTGGCCTGGACAGTGGGTGG - Intergenic
915287390 1:154861667-154861689 GTGCTTGGGAGGACTGAGGAAGG - Intronic
915934216 1:160081432-160081454 GTGGTACCCAGGACTGGGGAGGG + Intergenic
916366947 1:164040125-164040147 CTGCCTGCCTGGCCTGAGGAAGG + Intergenic
916853476 1:168727003-168727025 TTGGTTACCAGGACTGTGGAGGG - Intronic
917705520 1:177630207-177630229 GTGGTTGCCAGGAATTCGGAAGG + Intergenic
918045071 1:180936504-180936526 GTGGGTGCCTGACCTGAGGGCGG - Exonic
918241644 1:182625409-182625431 GTGGTTGCCTGGGGCTAGGAGGG - Intergenic
920203108 1:204272642-204272664 GTGGTTGCCTCTAGGGAGGAAGG - Intronic
922538465 1:226401139-226401161 GTGGTTGTCAGGAATTAGGAGGG + Intronic
922772047 1:228190799-228190821 GTGGTTCCAGGGGCTGAGGAGGG - Intergenic
923085749 1:230702435-230702457 GTGCTTTCCTGGACTTTGGATGG - Intergenic
924633719 1:245765598-245765620 ATGGTTGGTTGGACTGGGGAAGG + Intronic
1063128205 10:3154025-3154047 GTGGTTGACTGCAGTGGGGATGG - Intronic
1065583080 10:27191281-27191303 GTGGTTGCCAGAAGTTAGGAGGG + Intergenic
1066491709 10:35900860-35900882 GTGGCTGCCTGGCCACAGGAGGG + Intergenic
1067147594 10:43704421-43704443 GTGGTTGGCTGGGCTGAGGAAGG - Intergenic
1067297156 10:44981299-44981321 GTGGTTGCAGGGACTGGGGCAGG + Intronic
1067462459 10:46467781-46467803 GTTCTTGCCTGCACAGAGGACGG - Intergenic
1067624737 10:47916856-47916878 GTTCTTGCCTGCACAGAGGACGG + Intergenic
1067850237 10:49749927-49749949 GTGATTGGGTGGCCTGAGGAGGG - Intronic
1068611781 10:59068288-59068310 GGGGTTGGGTGGATTGAGGATGG - Intergenic
1068611912 10:59069641-59069663 GGGGTTGGGTGGATTGAGGATGG - Intergenic
1069135489 10:64758731-64758753 GTGGTTGCCAGGCCTGGGGTGGG - Intergenic
1069167631 10:65182687-65182709 GTGGTTGCCAGGATTGGGGAGGG - Intergenic
1069866389 10:71506212-71506234 GTGGTTGCCAGGGCTGGGGAAGG + Intronic
1069959285 10:72070201-72070223 GGGGTTTCCAGGACTGAGGTGGG - Intronic
1070589862 10:77794173-77794195 CTGTTAGCCTGGACAGAGGAAGG - Intronic
1070916455 10:80158236-80158258 GTGGTTGCCAGGAAAGAGGGTGG - Intronic
1071353622 10:84771000-84771022 GTGGTTGGGTGGAGTGAGGTGGG + Intergenic
1071738098 10:88324811-88324833 GTAGTTGCCAGGGCTGGGGAAGG - Intronic
1072308977 10:94136214-94136236 GTGGTTACCGGGGATGAGGAAGG + Intronic
1072841210 10:98776006-98776028 ATGGTTGTGGGGACTGAGGAGGG - Intronic
1072918054 10:99552180-99552202 GTGGTTACCGGGAATGGGGATGG + Intergenic
1074384445 10:113005761-113005783 TTGCTTGCCTGGAATAAGGAAGG + Intronic
1074407490 10:113191769-113191791 GTTGATGCCTGGGCTGGGGAGGG + Intergenic
1075402809 10:122173169-122173191 GGGGTTGTCTGGGGTGAGGAGGG - Intronic
1076288024 10:129320438-129320460 GTGGCTGCCAGGAATGGGGATGG - Intergenic
1076324984 10:129614105-129614127 GTGGGTGCCAGGGCTGGGGAAGG - Intronic
1076812233 10:132893217-132893239 GTGGCTGCCTGCACTTGGGAGGG - Intronic
1077086690 11:756003-756025 GTGAGTGCCTGGACTCGGGAGGG + Intronic
1077147774 11:1053598-1053620 GTGGCTGAGAGGACTGAGGACGG + Intergenic
1077182915 11:1224476-1224498 GGGGTTGCCTGGGTTGGGGAGGG + Intronic
1077189151 11:1248596-1248618 GTGGTCCCCGGGACGGAGGAGGG - Exonic
1077261668 11:1625124-1625146 GTGGCTGTCAGGGCTGAGGAGGG + Intergenic
1077583430 11:3432704-3432726 GTGGGTGCCGGGACTGAGGCAGG - Intergenic
1080099480 11:28443109-28443131 GAGGTTGCCTAGAGTGAGAAAGG - Intergenic
1080167031 11:29250996-29251018 GTGATTGCCAGGAATTAGGAAGG + Intergenic
1080265303 11:30393958-30393980 GTGGTTGCCAGGGGTTAGGATGG - Intronic
1080659863 11:34286923-34286945 GTGGTTGCCGGGGCTGGGGGAGG + Intronic
1081968463 11:47183376-47183398 GTAGCTCCCTGTACTGAGGAGGG + Intronic
1083765222 11:64838411-64838433 ATGCTTGCCTGCACTGAGGTGGG - Intronic
1084063489 11:66690338-66690360 GTGGCAGCCAGGACTGAGGCAGG - Intronic
1084283405 11:68114861-68114883 GTGATTGGCTGGGCTTAGGAGGG + Intronic
1084598067 11:70128962-70128984 GTGACCACCTGGACTGAGGATGG - Intronic
1084645951 11:70457959-70457981 GTGGTTGCCAGGAGTGTGGGTGG - Intergenic
1084712017 11:70849494-70849516 GTGGGTGCCTGGGCTCAGGGTGG + Intronic
1085522086 11:77144882-77144904 GAGCTGGCCTGGACTGAGCAGGG - Intronic
1086572916 11:88305810-88305832 GTGGTTGGCTGGAGGGAGAAGGG + Intronic
1088381050 11:109193066-109193088 GTGGCAGCCTGGGCTGGGGAAGG - Intergenic
1089174729 11:116540240-116540262 GTTGCTGCCTGGCCTCAGGATGG - Intergenic
1089320996 11:117626693-117626715 GTGGGTGCCTGCAATGATGATGG - Intronic
1089871393 11:121675489-121675511 GTGGTTGCCTGGATCCAGGAAGG - Intergenic
1090447698 11:126777972-126777994 ATGGTTGCAAGGACTGGGGACGG + Intronic
1091215140 11:133896734-133896756 GTGGTAGCCTGAGCTGAGGCAGG + Intergenic
1091572739 12:1703603-1703625 GTGTGTGCCGGGACTGAGGTGGG + Intronic
1092867357 12:12775273-12775295 GTGGTTGCCAGGGGTTAGGAGGG + Intronic
1096585428 12:52616686-52616708 GAGGTGGCCTGGACTGAACATGG - Intronic
1096848604 12:54421176-54421198 GAGTTTGCCTAGACTGAGAAAGG - Intergenic
1097031841 12:56095366-56095388 GTGGTTACCTGGAGAGAAGAGGG + Intronic
1098673924 12:73265869-73265891 CTGGTTGACTGGGCTCAGGAGGG - Intergenic
1099259610 12:80361143-80361165 GTGGTTACCAGGGCTGAGGGTGG - Intronic
1101213704 12:102560344-102560366 GTGCCTACCTGGACTGAGGGTGG - Intergenic
1101766048 12:107700353-107700375 GTGGTTGCCAGGGCTGGGGGTGG - Intronic
1102036127 12:109771449-109771471 GTGGATGCCTGGTCTCAGGGAGG - Intergenic
1103084425 12:118051589-118051611 GTGGTTGCCTGGAGAGTGCAGGG + Intronic
1103259807 12:119576922-119576944 TTGGTTGTCTCAACTGAGGATGG + Intergenic
1103507532 12:121452130-121452152 GTGGTTGCCCGGGCTGAGGGAGG + Intronic
1103805161 12:123566906-123566928 GTGGTTGCCTGGTAGGAGGTGGG + Intergenic
1103962635 12:124618496-124618518 GTGGTTGCCGGGGCTGGGGGAGG - Intergenic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1104836962 12:131797854-131797876 GTGGGTGCCTGGGCAGCGGAGGG - Intronic
1105416504 13:20217874-20217896 GTGGTTGCCAGGACTTAAGAAGG + Intergenic
1106110223 13:26770767-26770789 GTGGTTGCCTGGGGTTAGGGTGG + Intergenic
1106251205 13:27982941-27982963 GAGGTTGCTTGGACTGTGGTTGG - Intronic
1107161282 13:37231523-37231545 GTGGAAGCAGGGACTGAGGAGGG - Intergenic
1108447867 13:50527289-50527311 GTGCTGGCCACGACTGAGGAGGG - Intronic
1109180811 13:59212182-59212204 GTGGTTGTCTGGACATAGCATGG - Intergenic
1111910951 13:94311501-94311523 ATGGTATCATGGACTGAGGAAGG + Intronic
1112412751 13:99178194-99178216 GTGGTTGCCAGGCCTGAAGGAGG - Intergenic
1113873037 13:113574409-113574431 GTGGTTGCCAGGAATTAGAAGGG + Intergenic
1113918271 13:113887736-113887758 GTGGTTGCCAGGGGTGAGGGAGG - Intergenic
1114883775 14:26821902-26821924 GTTGCTGCCTGGAATGAGGAAGG - Intergenic
1116147607 14:41095507-41095529 GTGGTTGCCAGGGTTTAGGAGGG - Intergenic
1117865284 14:60142074-60142096 TTGGTTGCCTGGAATGGGGTGGG + Exonic
1119197716 14:72729750-72729772 GTGGTTGCCAGGCATTAGGACGG + Intronic
1122702837 14:103601795-103601817 GTGGTTGCCAGGGGTTAGGAGGG + Intronic
1125209975 15:37203106-37203128 GTGGTTACCTGTACTTAGCAAGG - Intergenic
1125316134 15:38433635-38433657 GTGGTTGCCTGGAGACAGGTAGG - Intergenic
1127793189 15:62416336-62416358 GAGGTTTTCTGGACTGAAGAGGG - Intronic
1128189999 15:65683893-65683915 GTGGTTGCCTGGTGTTAGGAAGG - Intronic
1130950794 15:88585873-88585895 GTGGTTGCCAGGAGTTAGGAAGG + Intergenic
1132690248 16:1178843-1178865 GTGGCTGCCAGGGCAGAGGAAGG + Intronic
1132949474 16:2552854-2552876 TTGATTGCCAGGACTGAGAAGGG + Intronic
1132964874 16:2647312-2647334 TTGATTGCCAGGACTGAGAAGGG - Intergenic
1133371910 16:5251655-5251677 GTGGCTGCTTGGAGTGAGGGCGG + Intergenic
1133537186 16:6713538-6713560 GTGGTTGTCTCAACTGGGGAGGG - Intronic
1134314350 16:13104673-13104695 GTGGTTGCCTGGGCTGGGGTGGG + Intronic
1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG + Intronic
1134765678 16:16755667-16755689 GTGGTTGCCTGGAGTTGGGGTGG - Intergenic
1135167532 16:20153458-20153480 GTGGTTGCCTGGAAGGGGGTTGG - Intergenic
1136230147 16:28880915-28880937 GTGCTGGCCTGGTTTGAGGAAGG + Exonic
1136656397 16:31711750-31711772 GTGGAAGCCTGGACTGGGGGAGG + Intergenic
1137668151 16:50263645-50263667 GTAGATGCCTGGACACAGGAGGG - Intronic
1138314648 16:56059439-56059461 GTGGTTGCCTGGGAGGAAGAAGG + Intergenic
1138326451 16:56175032-56175054 GTGGTTGCCTAGAGTGGGAAAGG - Intergenic
1138539398 16:57679319-57679341 GTGGCTGCCAGGCCTGAGCAGGG - Intronic
1139874221 16:70132435-70132457 GAGTTTGCCTGGTCTGAGGATGG + Intronic
1140361555 16:74348710-74348732 GAGTTTGCCTGGTCTGAGGATGG - Intergenic
1140728053 16:77831698-77831720 GTGGTTTCCTGGACTGAAAAGGG + Intronic
1142166140 16:88589787-88589809 CTCGTTGCCTGGACTGGGGGTGG + Intronic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1142728800 17:1836541-1836563 CTGGTTGCCTAGGGTGAGGATGG - Intronic
1144371430 17:14595191-14595213 GTGGTTGCCAGGACTGGGGGAGG + Intergenic
1148747504 17:49926942-49926964 GTGGGTGGCTGGACTGTGGATGG + Intergenic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1151044181 17:70900046-70900068 GTGTTTGCCAGGGCTTAGGATGG + Intergenic
1151593830 17:75064714-75064736 GTGGCTGCTTTTACTGAGGACGG - Exonic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151924945 17:77188309-77188331 GTGGTTGCCGGGGCTAAGGAAGG - Intronic
1152385260 17:79970259-79970281 GTGGCTGCCAGGGCTGGGGAAGG + Intronic
1152474332 17:80508159-80508181 GAGGTTGCCAGGGCTGGGGAGGG + Intergenic
1152932961 17:83119905-83119927 CTGGTTGCGTGGCCTGGGGAGGG + Intergenic
1153709387 18:7782600-7782622 GTGGTTGCCAGGGCTGGGGGAGG - Intronic
1154085048 18:11295904-11295926 TTGTTTGCCTGCTCTGAGGAAGG - Intergenic
1154146804 18:11873672-11873694 GTGCTTTCCAGGACTGAGGCCGG + Intronic
1154319903 18:13339952-13339974 GCAGTTGCCAGGGCTGAGGAGGG - Intronic
1154376716 18:13816951-13816973 GTGGGTCCCTGGACTGAGTGTGG + Intergenic
1156233408 18:35177712-35177734 GTTGCTGCCTGAGCTGAGGAAGG + Intergenic
1156563990 18:38163162-38163184 TTGGTTTCCTGAACTGTGGAGGG - Intergenic
1157637395 18:49172043-49172065 GTGGTTGCCTGGAAGGGTGAGGG - Intronic
1158003982 18:52651071-52651093 GTGGTTGCCTGAAGTCAGGGAGG - Intronic
1158027652 18:52920999-52921021 GTGGTTGCCTGGAGTTTGGTAGG + Intronic
1158323124 18:56285154-56285176 GTGTCTGCCAGCACTGAGGATGG - Intergenic
1158332768 18:56380866-56380888 GTGGTTGCCAGGGGTGAGGAGGG + Intergenic
1158910795 18:62059627-62059649 GTTGTTGCCTGGGCTTGGGATGG + Intronic
1159907771 18:74113273-74113295 GTGGTTGCCAGGAATTAGGGAGG + Intronic
1159941345 18:74411328-74411350 GCGGTTCCCTGGACCGTGGAAGG + Intergenic
1160296000 18:77637519-77637541 GTGGCTGCCTGGCTTGGGGAGGG + Intergenic
1160686719 19:440197-440219 GTGGGTGCCGGGGCTGGGGAGGG + Intronic
1160855053 19:1213437-1213459 GTGGGTGCCGGGACTGGGGAGGG - Intronic
1160881177 19:1321368-1321390 GTGGGTGCCAGGGCTGGGGAGGG - Intergenic
1161300121 19:3538450-3538472 GTGGGTGCCGGGACTGGGGAGGG - Intronic
1161346328 19:3770495-3770517 GTGGTGGCCTGGCCTGACCACGG + Exonic
1162301395 19:9847072-9847094 GGGGTGGCCTGGAGTCAGGAAGG + Intronic
1162893014 19:13747710-13747732 GTAGTGGGCTGGACAGAGGATGG + Intronic
1166342460 19:42146937-42146959 GTGGTGGCCTGGACTGCAGTGGG - Intronic
1166938587 19:46349816-46349838 GTGGCTGCCTGGAGAGAGGGTGG + Intronic
1167405122 19:49301711-49301733 GTGGTTTCAGGGACAGAGGAAGG - Intronic
1167508691 19:49884370-49884392 GTGGGTGCCAGGCCTGGGGACGG + Intronic
1167642863 19:50691377-50691399 GAGGTTGCCTCCAGTGAGGAAGG - Intronic
1168107069 19:54172136-54172158 CTGGTTTCCTGGTCTGAGGGAGG - Intronic
1168107234 19:54172579-54172601 CTGGTTTCCTGGTCTGAGGGAGG - Intronic
1168329365 19:55557775-55557797 GTGGTTGCCAGGAGCTAGGAGGG - Intergenic
927681735 2:25144076-25144098 GAGATGGCCTGGCCTGAGGATGG + Intronic
927940317 2:27099430-27099452 GTCTGTGCCTGGGCTGAGGAGGG + Exonic
928936202 2:36680851-36680873 GTGGTTGCCAGGAATTAGGGAGG - Intergenic
929044360 2:37775738-37775760 TTTGTTGCCAGGACTGAGGCAGG - Intergenic
929946114 2:46373607-46373629 GTGGTTGCCTGGAACCAGGGTGG + Intronic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
933312022 2:80672746-80672768 TTAGTTGCCAGAACTGAGGAGGG - Intergenic
933517954 2:83330149-83330171 ATTCTTGCCTGGACTGAGGTAGG - Intergenic
934535934 2:95133439-95133461 GTGGTTGTCAGGAGTTAGGAAGG + Intronic
934573829 2:95388342-95388364 GGAGTTGACTGGACTGAAGATGG + Intergenic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
935735534 2:106103928-106103950 GTGGTTGCTTTGGCTGAGGTGGG + Intronic
936478595 2:112864295-112864317 GTGTTTACCTGGATTGAGGGTGG + Intergenic
937068541 2:119041531-119041553 GTGGTTGCCGGGGTTAAGGAAGG - Intergenic
937154623 2:119710320-119710342 GTGCCTCCCTTGACTGAGGAGGG - Intergenic
939173845 2:138726957-138726979 GTGGCTGCCTGGGGTGAGCAGGG - Intronic
939853400 2:147327182-147327204 GTGGTTACCATGAGTGAGGAGGG + Intergenic
940506842 2:154566425-154566447 GTTGTTTCCAGGCCTGAGGAAGG + Intergenic
941110680 2:161416728-161416750 GTGGCTGGCTGGACTGAGAGAGG - Exonic
941131785 2:161659979-161660001 GTGGTTGCCTGGGGTGAAGAGGG + Intronic
942573757 2:177340791-177340813 GTGGTTGCCTGGGGTTAGGGTGG + Intronic
943441605 2:187933473-187933495 GTGGATGCCAGGACTTGGGAAGG - Intergenic
944152627 2:196576535-196576557 GTGGTTGCCAGGAATTGGGAAGG + Intronic
944155320 2:196601544-196601566 TGGGTTGCCTGGACTGCAGAAGG + Intergenic
944275740 2:197835468-197835490 ATGGTTGCCAGGAATGGGGAGGG - Intronic
945892921 2:215449360-215449382 GTGCTTGCCTGGGGTCAGGAAGG - Intergenic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
946890451 2:224270311-224270333 GTGGTTGCCAGGACTTAGAGAGG + Intergenic
947232788 2:227904788-227904810 GCGGTTGGCTGGGGTGAGGATGG - Intronic
947697898 2:232208193-232208215 GTGGTTGCCAGAACTGGGAAAGG - Intronic
947807502 2:232978680-232978702 GTGGTTGCCGGGGCTGGGGGCGG - Intronic
948548103 2:238746696-238746718 GGGGTTCCCTGGAGTGTGGATGG - Intergenic
948614366 2:239188891-239188913 AGGGTTGACTGGACTGAGGCGGG - Intronic
948792465 2:240386072-240386094 GTGCTGGGCTGGACTGAGGTGGG + Intergenic
949033303 2:241806307-241806329 GAGGTTCCCTGGGCTGAGGGGGG - Intergenic
949050152 2:241893459-241893481 GTGGTCTCCTGGACAGAGGAGGG - Intergenic
1168995392 20:2129242-2129264 GGGTTTACATGGACTGAGGATGG - Intronic
1169157849 20:3348902-3348924 GTGGTTGCCTGGGGTTGGGATGG + Intronic
1170541468 20:17392599-17392621 GTGGTTGCCAGGACTGCGAGTGG - Intronic
1170557477 20:17526334-17526356 GTGGTTGTCAGGGCTGGGGATGG - Intronic
1171433018 20:25097984-25098006 GTGGTTGCCAGGAATTTGGAGGG + Intergenic
1173234378 20:41231033-41231055 GTGGTTGCCAGGAGTTAGGGAGG - Intronic
1173499020 20:43539065-43539087 GTGGTTGGTAGGGCTGAGGATGG + Intronic
1173539128 20:43838279-43838301 CTGGCTGCTTGGTCTGAGGAGGG + Intergenic
1173867633 20:46322726-46322748 GGGGTTGCCTGGACCTAGGTAGG + Intergenic
1174145963 20:48452725-48452747 CTGCTTCCTTGGACTGAGGATGG - Intergenic
1174226180 20:49002412-49002434 GTGGTTGCCTGTGGTCAGGAGGG - Intronic
1174529674 20:51201051-51201073 GTGGGTGCCTGGAGTAAGGTGGG - Intergenic
1174618465 20:51855145-51855167 GTGGTTGCCAGGAATGAAGGAGG - Intergenic
1175658818 20:60794523-60794545 GTGGTTGCTGGAACTGGGGAAGG - Intergenic
1175798957 20:61790125-61790147 GTGGATGGGTGGACAGAGGATGG - Intronic
1175919708 20:62444988-62445010 GTGGCTGCTGGCACTGAGGAAGG + Intergenic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1176130045 20:63492938-63492960 GTGGATGGATGGACAGAGGATGG + Intronic
1176210092 20:63915597-63915619 GTGCTTGCCTGGCCTGATAAGGG - Intronic
1176236681 20:64056747-64056769 GACGTTTCCTGGACTCAGGATGG + Intronic
1176274765 20:64258126-64258148 GAGGTGGCTTTGACTGAGGACGG + Intronic
1176306250 21:5124800-5124822 ATGGTTGGCTGCACTGAGGTTGG + Exonic
1176676341 21:9781723-9781745 GTGGTTGCCTGCACTCAGACTGG - Intergenic
1178698311 21:34813140-34813162 TTGGTTGCCACAACTGAGGAAGG + Intronic
1178876862 21:36420542-36420564 GTTGTAGCCTGGAGTGAGAAGGG + Intergenic
1179221428 21:39411196-39411218 GTGGTTGCCTCGGGTGAGGTAGG + Intronic
1179850808 21:44137230-44137252 ATGGTTGGCTGCACTGAGGTTGG - Exonic
1180185739 21:46138406-46138428 GTGGTTGGCTGGGCTGAGCCAGG - Intronic
1180799612 22:18625677-18625699 TTGCTTGCCTGGACTGGGGTGGG + Intergenic
1180946718 22:19698464-19698486 GTAGTGGCCTGGACTGGGGTGGG + Intergenic
1181222104 22:21369589-21369611 TTGCTTGCCTGGACTGGGGTGGG - Intergenic
1181391256 22:22583287-22583309 GTGGGTGTCAGGACTGGGGAGGG - Intergenic
1181637863 22:24182583-24182605 TTGCTTGCCTGGACTGGGGTGGG - Intronic
1181752825 22:25001544-25001566 GTGGTGGTCTGGACTGGGGTGGG + Intronic
1181774247 22:25148221-25148243 GGGGGTGCCAGGACTGAGAAAGG - Intronic
1182104434 22:27679325-27679347 GTGGCTGCCTGAACGGAGGAAGG + Intergenic
1182378125 22:29863547-29863569 GTGGTTGCCAGGAGTTAGCAAGG - Intergenic
1183251392 22:36732846-36732868 GTGTTTCCCAGGACTGAGGAGGG - Intergenic
1184262370 22:43326317-43326339 ATGGTTGCCTGATCTAAGGAGGG - Intronic
1184465437 22:44666721-44666743 GTGCTTGCCAGGAGGGAGGAGGG + Intergenic
1185169437 22:49284107-49284129 GGGGTTTCCAGGAATGAGGAGGG + Intergenic
950092071 3:10303012-10303034 GTGGCTGCCAGGGCTGGGGAGGG + Intronic
950414113 3:12858577-12858599 GTGGATGCCAGGCCTGAGGAAGG - Intronic
950414377 3:12860312-12860334 GTGGATGCCAGGTCTGAGGAAGG - Intronic
950497070 3:13340186-13340208 GTGGTGGCCTGCACTGGGGCTGG + Intronic
950894853 3:16439676-16439698 GTGGGTGGCTGGAGTGAGGAAGG + Intronic
951955068 3:28244405-28244427 GTGGTTGCATTGAATAAGGATGG + Intronic
952513138 3:34076941-34076963 ATGGTGGCCTGGACTAGGGATGG + Intergenic
952639024 3:35569032-35569054 GTGGCTGCCTGAAATGAGGCAGG + Intergenic
953006513 3:38984213-38984235 ATGGGTGCCTCCACTGAGGAAGG + Intergenic
953775392 3:45812337-45812359 GTAGTGGCCTAGACTGAGGTAGG - Intergenic
954574652 3:51669257-51669279 GTGATTCCTTGGACAGAGGAAGG + Intronic
954603842 3:51893663-51893685 GTGGTTCCCTGCACAGAGGGAGG - Intergenic
955719632 3:61867294-61867316 TTGGTTGCCTGAAGTGAGAATGG + Intronic
956954670 3:74322969-74322991 GTGGTTGCCAGAAGTTAGGAGGG + Intronic
957819929 3:85359104-85359126 GTGTTAGGCTTGACTGAGGAGGG + Intronic
959920057 3:111859722-111859744 GTGGCTGCCCGGGCCGAGGAGGG + Intronic
959933534 3:112007408-112007430 GTGGTTGCCAGGGTTGAGGGTGG - Intronic
959985408 3:112565819-112565841 GTGGTTGGCTGGAGAGAGGTTGG + Intronic
961459704 3:127042646-127042668 CTGGCTGCCTGGAGTGAGGTTGG + Intergenic
962744313 3:138386275-138386297 ATGGTTTCAGGGACTGAGGAGGG - Intronic
963435973 3:145266434-145266456 GTGGTAGCAAGGACGGAGGAGGG + Intergenic
963841255 3:150108932-150108954 GTGGTTGCCGGGGTTGAGGAGGG - Intergenic
965848844 3:172996811-172996833 CTGGTTGCCAGGGCTTAGGAAGG - Intronic
966403297 3:179568458-179568480 GTGGTTACATGAACTGAAGAAGG - Intronic
967818653 3:193819686-193819708 GAAGGTGGCTGGACTGAGGAAGG + Intergenic
968233248 3:197016458-197016480 GTGGGTGCCTGGTCTGAGGTCGG - Intronic
968291348 3:197542121-197542143 GTCCCTGCCTGGACTGAGGCTGG + Intronic
968481478 4:834968-834990 GTGGTTCCCTGGAGTGGGGTGGG + Intergenic
968519870 4:1030411-1030433 GTGGCTGCCTGGGTTGGGGAAGG + Intergenic
969721151 4:8893652-8893674 GTGGGTGGCGGAACTGAGGAGGG - Intergenic
970783944 4:19773228-19773250 GTGGTTGGCTAGTGTGAGGAAGG - Intergenic
971741938 4:30532568-30532590 GTGGTTACCAGGGCTCAGGATGG - Intergenic
974989356 4:69065236-69065258 GTGGGTACCTAGACTGAGGGTGG - Intronic
976122980 4:81803163-81803185 GTGGTTGCCTCCAGTGAGGGTGG - Intronic
976354083 4:84095257-84095279 GTGGCTGCCTGGGATGAGAATGG + Intergenic
977611244 4:99034253-99034275 GTGTCTTCCTGGACTGTGGAAGG + Exonic
977744881 4:100535068-100535090 GTTGTTGCCTTGGCTGGGGAAGG - Intronic
977950875 4:102968962-102968984 GTGGTAGCCTGGGCTGGGGGAGG + Intronic
978036935 4:104006729-104006751 GTGATTCACTGGACTGAGCATGG - Intergenic
979075381 4:116263801-116263823 GATGTTGCCAGGACTGGGGATGG - Intergenic
979943571 4:126794977-126794999 GTGGTTGCCAGGGCGGAGGGAGG + Intergenic
980512431 4:133812124-133812146 CTGGTAGCCTGGGCTCAGGAGGG - Intergenic
982624291 4:157746041-157746063 GTGGTTACCAGGAGTGGGGAGGG + Intergenic
984451994 4:179914194-179914216 GTGCCCACCTGGACTGAGGATGG - Intergenic
984551225 4:181161425-181161447 CTGGCAGCCTGGACAGAGGAAGG - Intergenic
985399188 4:189577029-189577051 GTGGTTGCCTGCACTCAGACTGG + Intergenic
986667279 5:10114636-10114658 GTGGTTGACAGGGCTGAGCATGG + Intergenic
988539922 5:32099565-32099587 GTGTTTCCCTGTATTGAGGAGGG - Intronic
989015625 5:36928691-36928713 GTAGTTGCCAGGACTGGAGAGGG - Intronic
989097427 5:37794398-37794420 GTGGTTGCCACTACTGGGGATGG - Intergenic
991099525 5:62777235-62777257 GCAGTTGCCCGGACTAAGGAAGG + Intergenic
991926602 5:71711819-71711841 GTGGTTGCCTGGGGACAGGATGG + Intergenic
992853851 5:80839897-80839919 GTGGTTGCCTCTAGTGAGTAGGG - Intronic
995965214 5:117898426-117898448 GTGGTTGCCAGCATTTAGGAGGG + Intergenic
997446961 5:133947331-133947353 GTGATTGCCTGTACTGAGCCAGG - Intergenic
997666339 5:135632381-135632403 GTGGTAGCCTGGACTCAAGAAGG + Intergenic
997987779 5:138517451-138517473 GTGGTTGCCTAGAATGAGACAGG + Intronic
998165217 5:139838812-139838834 ATGGGGGCCTGGGCTGAGGATGG - Intronic
998171723 5:139876310-139876332 GTGGTTGCCGGGGCTGGAGAGGG + Intronic
998540847 5:142980062-142980084 GTGGTTACCTGGAGGGAGAAGGG - Intronic
999447220 5:151649602-151649624 TAGGTTTCCTGGCCTGAGGAGGG + Intergenic
999951256 5:156653527-156653549 GTGGTAGCCCGGACTGAGTCAGG + Intronic
1000305392 5:159989894-159989916 GTGGTTGTCAGGGCTGATGAAGG - Intergenic
1000844972 5:166268502-166268524 GTGGTTGCCTAGTCTGAGAGTGG + Intergenic
1001549657 5:172593784-172593806 GGGGCTGCCAGGACTCAGGAGGG + Intergenic
1002374985 5:178782257-178782279 GTGGATGCGTGGAATGAGGAAGG - Intergenic
1002788220 6:419646-419668 GGGGTTGCCTGGAAACAGGAAGG + Intergenic
1002953060 6:1834833-1834855 GTGGTTGCCTGGTTGCAGGAAGG - Intronic
1003020543 6:2505260-2505282 CTGATGGCCTGGACTGGGGAAGG - Intergenic
1003055321 6:2812958-2812980 ATGATTGCCTGGACTGGGGAAGG - Intergenic
1003369460 6:5510368-5510390 GGGGTTGCCTGGAAGGAGGCAGG - Intronic
1003518235 6:6835461-6835483 GTGGTTGCCTGTGAGGAGGAGGG + Intergenic
1003622661 6:7714863-7714885 CTGGTGGCCTGGGCTGGGGAAGG + Intergenic
1005564464 6:27076767-27076789 GTGGTTGCCAGGATCTAGGATGG - Intergenic
1006794401 6:36722498-36722520 TTGGTTCCCTGGAGTGAGGCGGG - Exonic
1007701413 6:43768595-43768617 GTGGAGGCATGGACTGAGAATGG - Intergenic
1007756461 6:44102759-44102781 GTGGAGGCCTGGGCTGAGGCAGG - Intergenic
1008688998 6:53956578-53956600 GTGGGTGCCTGGTCAGAGGGCGG + Intronic
1008748030 6:54697140-54697162 CTTTTTGCCTGGACTGTGGAAGG + Intergenic
1009349957 6:62661658-62661680 GTGGTTTCCAGGCTTGAGGATGG + Intergenic
1009413377 6:63392221-63392243 CTGGTTGGCAGCACTGAGGAAGG - Intergenic
1009867836 6:69418997-69419019 AGGCTTGCCTGGACTGAAGAAGG + Intergenic
1010767356 6:79791306-79791328 GAGGTTGGCTGGGATGAGGAGGG - Intergenic
1011716511 6:90111239-90111261 GTGGTGGCCTGGACAGAAGATGG - Intronic
1016396839 6:143632771-143632793 GTGGTTGCCAGGATTTAGGGGGG - Intronic
1017619105 6:156276674-156276696 GTGGTTGCCTGGGGTGGGGTAGG - Intergenic
1018107680 6:160504407-160504429 GATGTTGCCAGTACTGAGGATGG + Intergenic
1018583017 6:165324076-165324098 AGGGTTGCCTGAACTGAGGAAGG - Intergenic
1018911080 6:168101240-168101262 GGGGTTTCCAGGACTGAGGCGGG - Intergenic
1019092357 6:169549850-169549872 GTGGTTGACAGGAGTTAGGAAGG + Intronic
1019609322 7:1929031-1929053 GTCCCTGCCTGGGCTGAGGACGG - Intronic
1020459683 7:8414666-8414688 ATGGTTGCGTGTAGTGAGGAAGG + Intergenic
1021666282 7:22984126-22984148 GTTGTTGCCAGGACTGCAGATGG + Intronic
1022654511 7:32306491-32306513 GTGGGAGCCTGGACTAAGGTGGG - Intergenic
1023379447 7:39591846-39591868 GTGGTTGCCAGGAATTAGGTAGG - Intronic
1024311244 7:47971308-47971330 TGGGTTACCAGGACTGAGGATGG + Intronic
1024565162 7:50674494-50674516 GTGGCTGGATGGACCGAGGAGGG + Exonic
1026103849 7:67405307-67405329 GTGATTGCCTGGGGTGAGGGTGG - Intergenic
1026152653 7:67801357-67801379 AAGGTTGCCTTGCCTGAGGAAGG - Intergenic
1027360145 7:77400044-77400066 GTGTTTGGCTGGACTTAGGGTGG - Intronic
1028128889 7:87147238-87147260 GTGGTGGGCTGGAGTGAGGCAGG - Intergenic
1030289194 7:107855475-107855497 GTGGTTGGCAGGAGTGAGGGGGG + Intergenic
1030856634 7:114565688-114565710 ATGGTGGTGTGGACTGAGGAAGG - Intronic
1031218538 7:118930604-118930626 GTGGTTTCCTTAACTGAAGATGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034475778 7:151280903-151280925 GTGGTTGCCTCCAGTGAGGCTGG + Intergenic
1035741976 8:1935458-1935480 GTGGTTGCCGAGACTGGGGGAGG - Intronic
1036064792 8:5367822-5367844 GTGGTTTCCAGGAGTGAGGGAGG + Intergenic
1036622612 8:10434825-10434847 GTGGTTGCCAGGGGTCAGGAGGG - Intergenic
1037679496 8:21083832-21083854 GTGGTTGCCAGGGATAAGGATGG - Intergenic
1037712099 8:21362854-21362876 GTTGTTGCCTGGACTGAGATGGG - Intergenic
1038491801 8:27976957-27976979 GTGGCAGCCTGGACTAAGGCAGG - Intronic
1038494974 8:27994950-27994972 GTGATTGCCTTGATAGAGGAGGG + Intergenic
1039785656 8:40832302-40832324 GTGTTTGCCTGAACTGAGCTGGG + Intronic
1042158931 8:65872590-65872612 CTGGATGCCTGGACTCAGCATGG - Intergenic
1042876612 8:73446263-73446285 ATGGTTGCCAGGGCTGGGGATGG + Intronic
1043396064 8:79838359-79838381 GTGGTTGCCAGGAATTAGGGAGG + Intergenic
1043759536 8:84050088-84050110 GAGATTGCATGGACAGAGGAAGG - Intergenic
1045540197 8:103076924-103076946 GTGGTTGCCAGGAACCAGGATGG + Intergenic
1045563014 8:103283949-103283971 GTGGTTGCCAGGGGTTAGGAGGG - Intergenic
1045657949 8:104406314-104406336 ATGGTTACCTGCACTGATGATGG + Intronic
1045990675 8:108303202-108303224 GTGGTTACCTGCGCTGGGGAAGG - Intronic
1047678686 8:127231155-127231177 GTGTCTGCCTGGGCAGAGGATGG - Intergenic
1049253285 8:141600746-141600768 GAGGCTGGCTGGCCTGAGGAGGG + Intergenic
1049800427 8:144515121-144515143 GTGGCTGCCAGGGCTGAGGCTGG - Intronic
1049812802 8:144583044-144583066 GTGGTTTGCTGGACGGTGGACGG - Intronic
1050054423 9:1637098-1637120 TTGGCAGCCTGGGCTGAGGATGG - Intergenic
1050111408 9:2220397-2220419 GTGGTTGCCTGGGATTATGAGGG - Intergenic
1050665874 9:7936240-7936262 ATGGTTGCCCACACTGAGGAAGG + Intergenic
1051605724 9:18916316-18916338 CTGTTTGCCTGGTCTGAAGAGGG + Intergenic
1051887410 9:21908131-21908153 GTGGTTACCAGGATTAAGGAAGG - Intronic
1052047024 9:23805801-23805823 GTGTTTGCCAGGAATAAGGAGGG - Intronic
1052147063 9:25062294-25062316 GTGGTTTCCTGGAGTTAAGATGG - Intergenic
1052790734 9:32873380-32873402 GTGGTTCGGTGGACTGTGGAGGG - Intergenic
1052956676 9:34257761-34257783 GTGGGTGGCTGGTCAGAGGATGG + Exonic
1053506647 9:38649070-38649092 GTGGATGTCTGGACTGGGAAAGG + Intergenic
1053568936 9:39284251-39284273 GAGGTTGAGTGGAGTGAGGAAGG - Intronic
1053834902 9:42125286-42125308 GAGGTTGAGTGGAGTGAGGAAGG - Intronic
1054128208 9:61334757-61334779 GAGGTTGAGTGGAGTGAGGAAGG + Intergenic
1055281984 9:74685016-74685038 GTTGTTGTGTGGACTGAGGGAGG - Intronic
1055561890 9:77529445-77529467 GCATTTCCCTGGACTGAGGATGG - Intronic
1056547791 9:87627462-87627484 GTGGGTGGCTGGGCTGAGCAGGG - Intronic
1056844853 9:90028855-90028877 GTGGTTGCCAGGAGTTAGAAGGG + Intergenic
1057118408 9:92547636-92547658 GTGGTTGCCTGAAATGAAGGGGG + Intronic
1059246448 9:112853696-112853718 GTGGTTGCCGGGACTCAGGATGG + Intronic
1059313018 9:113401331-113401353 GGCGTGGCCTGGACTGTGGAGGG - Exonic
1060945020 9:127565300-127565322 GTGGTTGCCTAGATTTAGGAGGG + Intronic
1061745105 9:132733851-132733873 GTGGGTGCCTGGACTGGCCAGGG + Intronic
1061870180 9:133516283-133516305 GTTGTTTCCTGGAATGAGGGTGG + Intronic
1061963592 9:134000394-134000416 GTGGTTGCCATGGCTGAGGATGG - Intergenic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1186510531 X:10126688-10126710 TTTGTTCCCTGGACTGAAGATGG - Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1189160227 X:38803531-38803553 GTGGTTGCCGGGGATGAAGAGGG - Exonic
1189324700 X:40105446-40105468 GTGGTCGCCTGGGGCGAGGAGGG - Intronic
1190288035 X:48973416-48973438 ACGGTTGCATGGACTGATGATGG - Intergenic
1190493669 X:51006825-51006847 GTGGTAGCCAGGGCTCAGGAAGG + Intergenic
1190511101 X:51175274-51175296 GTGGTAGCCAGGGCTCAGGAAGG - Intergenic
1191115125 X:56844445-56844467 GTGGATCCCAAGACTGAGGAGGG + Intergenic
1192150421 X:68708899-68708921 CAGGTGGCCCGGACTGAGGATGG - Intronic
1194205545 X:91007096-91007118 GTGGTTGCCGGGGCTCAAGAAGG - Intergenic
1195501807 X:105610475-105610497 GTGGTTGCCTGGGGCAAGGATGG - Intronic
1197455132 X:126670149-126670171 CTGGTTGCCTGGGCTCAGGAGGG - Intergenic
1198968994 X:142258985-142259007 GTGGTTGCCTGGATTTCAGAGGG + Intergenic