ID: 1104389994

View in Genome Browser
Species Human (GRCh38)
Location 12:128384079-128384101
Sequence CAAAACAAAAAGAGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 715}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104389988_1104389994 13 Left 1104389988 12:128384043-128384065 CCAAAGAAACCCAAACAAACAAA 0: 1
1: 4
2: 46
3: 355
4: 2478
Right 1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG 0: 1
1: 0
2: 5
3: 53
4: 715
1104389986_1104389994 22 Left 1104389986 12:128384034-128384056 CCACTACCACCAAAGAAACCCAA 0: 1
1: 0
2: 6
3: 32
4: 363
Right 1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG 0: 1
1: 0
2: 5
3: 53
4: 715
1104389989_1104389994 4 Left 1104389989 12:128384052-128384074 CCCAAACAAACAAACAAACAAAT 0: 20
1: 640
2: 659
3: 1705
4: 7633
Right 1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG 0: 1
1: 0
2: 5
3: 53
4: 715
1104389987_1104389994 16 Left 1104389987 12:128384040-128384062 CCACCAAAGAAACCCAAACAAAC 0: 1
1: 1
2: 11
3: 98
4: 776
Right 1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG 0: 1
1: 0
2: 5
3: 53
4: 715
1104389990_1104389994 3 Left 1104389990 12:128384053-128384075 CCAAACAAACAAACAAACAAATC 0: 3
1: 68
2: 627
3: 1339
4: 3750
Right 1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG 0: 1
1: 0
2: 5
3: 53
4: 715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104389994 Original CRISPR CAAAACAAAAAGAGGTGGTC AGG Intronic
901708398 1:11094594-11094616 AAAAAAAAAAAAAGGTGGCCTGG - Intronic
901826582 1:11865845-11865867 AAAAAAAAAAAGAGGAGGTTAGG - Intergenic
902258007 1:15203242-15203264 AAAAACAAAAAACGGTGGCCAGG - Intronic
902301523 1:15505842-15505864 GAAAACAACAGGAGGTGGGCAGG + Intronic
903060911 1:20668013-20668035 AAAAAAAAAAAGAGGTGGCCGGG + Intronic
903428260 1:23270924-23270946 CAAAAAAAAAAGGGGGGGCCGGG - Intergenic
903455989 1:23487133-23487155 AAAAAAAAAAAGAGGGGGCCGGG - Intergenic
903643795 1:24878409-24878431 CAAACAAAAAAGAGGTGATTAGG - Intergenic
903866345 1:26401172-26401194 AGAAAGAAAAAGAGGTGGCCGGG - Intergenic
904146437 1:28395957-28395979 CAAAAAAAAAAAAGTTGGCCGGG - Intronic
904302778 1:29566100-29566122 CAAAACAAAATCAGGTGGGTTGG - Intergenic
904562414 1:31407501-31407523 AAAAAAAAAAAGAAGTGGCCTGG - Intergenic
905038806 1:34935540-34935562 GAAAAAGAAAAGAGGTGGTTGGG - Intergenic
905187594 1:36207721-36207743 CTAAACAAAAAGAGGAGTTCAGG + Intergenic
905230360 1:36511383-36511405 AAAAAAAAAAAGAGGAAGTCAGG - Intergenic
905383534 1:37581956-37581978 TAAAAAAAAAAGATGTGGCCGGG - Intronic
905688356 1:39925120-39925142 CAAAAAAAAAAGAGGTTATGGGG + Intergenic
905689517 1:39932626-39932648 CAAAACAAAAACAGGTGGCCGGG + Intergenic
905723110 1:40224567-40224589 AAAAAAAAAAAGATGTGGCCAGG - Intronic
906373506 1:45274543-45274565 CAATATAAAAAGAGGGGGTTAGG - Intronic
907357524 1:53888733-53888755 AAAAACAAAAACAGCTGGTGTGG + Intronic
907361150 1:53916185-53916207 AAAAAAAAAAAGAGGTGATTGGG + Intergenic
908203801 1:61824359-61824381 CAAAAAAAAAAAAAGTGGACCGG - Intronic
908814782 1:68020690-68020712 CAAAACAAAAAAAGTGGGCCAGG - Intergenic
910485334 1:87707224-87707246 CCAAACAAAAAGAGGGACTCTGG + Intergenic
910688980 1:89947076-89947098 CAAAAAAAAAAAAGGTGGGGCGG + Intergenic
912015195 1:105026078-105026100 CAAAACAAAAAGGCATGGTATGG + Intergenic
912228758 1:107767628-107767650 CAAAACACAAAGAACTGTTCAGG + Intronic
912419447 1:109533087-109533109 GAAAACAAAAAGAACTGGGCTGG - Intergenic
912427435 1:109607154-109607176 TAAAAAAAAAAAAGGTGGCCAGG + Exonic
914754500 1:150554981-150555003 AAAAAAAAAAAAAGGTGGTCAGG - Intronic
914758837 1:150582402-150582424 CAAAACATAAATGGGTGGTATGG - Intergenic
915024440 1:152814085-152814107 TAAAGCAAAGAGAGGTGGTGAGG + Intergenic
915157662 1:153891588-153891610 AAAAAAAAAAAGAGGTGGGGGGG + Intronic
915578794 1:156800749-156800771 AAAAAAAAAAAGTGGTGGTGGGG - Exonic
915601669 1:156926570-156926592 CAAAAAAAAAAGAAGAGGTGGGG - Intronic
916048213 1:161016656-161016678 CAAAAAAAAAAAAAGTGATCTGG + Intronic
916048758 1:161020541-161020563 AAAATCAAATGGAGGTGGTCTGG - Intronic
917579774 1:176364025-176364047 GAAAAAAAAAAGAGGAGCTCAGG - Intergenic
917951379 1:180040416-180040438 GAAAACAAAAAATGGTGGTAAGG - Intronic
918015445 1:180629167-180629189 CAAAAAAAAAAAAGATGGGCAGG - Intergenic
918145242 1:181750409-181750431 CAAAACAAAAAAATGGGGTTGGG - Intronic
918667765 1:187173031-187173053 CAAAAAAAAAAAAGGTGTTCTGG - Intergenic
919188028 1:194179991-194180013 AAAAAAAAAAACAGGTTGTCTGG + Intergenic
919318791 1:196007346-196007368 AAAAAAAAAAAAAGGTAGTCTGG + Intergenic
919435533 1:197554843-197554865 AAAAAAAAAAAGAGGGGGTGGGG + Intronic
919659304 1:200228317-200228339 AAAAAAAAAAAAACGTGGTCAGG + Intergenic
919740250 1:200976967-200976989 CAAAACAAATAGGCCTGGTCAGG + Intronic
920377390 1:205516491-205516513 CAAAACAAAAAGAGGGACTTGGG + Intronic
920726090 1:208436529-208436551 CAAAACAAAATGTGGTAGTCAGG + Intergenic
920764726 1:208821179-208821201 CGACACAGAAAGAGATGGTCAGG + Intergenic
921262967 1:213400057-213400079 CATAGAAAAAAGAGGTGGGCGGG + Intergenic
921419914 1:214934444-214934466 GAAAAGAAAAAGTGGTGGACAGG + Intergenic
921654339 1:217717026-217717048 CAAAACATAAAGAGGCAGTGTGG - Intronic
922332418 1:224588957-224588979 AAAAAAAAAAACAGGGGGTCAGG - Intronic
922424368 1:225479923-225479945 AAAAAAAAAAAGAAGTGGCCAGG + Intergenic
922778450 1:228229236-228229258 AAAAACAAGAAGAGTTGGTGAGG - Intronic
922849742 1:228722619-228722641 AAAAAAAAAAAAAGGAGGTCAGG - Intergenic
923156773 1:231285984-231286006 CAAAAAAAAAAGAAGTGGGATGG + Intergenic
923692913 1:236213558-236213580 TAAAAAAAAAAAAGGTGGGCAGG + Intronic
923913057 1:238471433-238471455 GAAAACAAAAACAAGTGGCCGGG + Intergenic
923935523 1:238755541-238755563 CAAAACACAAAGAAAAGGTCTGG - Intergenic
923982149 1:239337155-239337177 CCAAACAAAAAGTGGTGGCAGGG + Intergenic
924111269 1:240702256-240702278 CAAAAGAAGAAGATGTGGACAGG + Intergenic
1062862985 10:824562-824584 CAAAACCAAAAATGGTGGGCAGG + Intronic
1063151549 10:3341453-3341475 CAAAACAACAAGTGGTGGTGAGG + Intergenic
1063380122 10:5579199-5579221 CAAAAAAAAAAAAGGGGGCCAGG + Intergenic
1063409243 10:5824117-5824139 CAAAAAAAAAATAGCTGGGCAGG + Intronic
1063687399 10:8250355-8250377 CAAATCAACAAGGTGTGGTCTGG + Intergenic
1063823932 10:9872211-9872233 CAAAACTGAAAGAGGAGGACAGG + Intergenic
1064149820 10:12853346-12853368 CAAAAAAAAAAGTTGTGGCCAGG - Intergenic
1064573290 10:16718683-16718705 CAACAAAAAAAGTGGTGGCCCGG + Intronic
1065028971 10:21566327-21566349 CAAAAAAAAAAAAGGGGGTGGGG - Intronic
1065522997 10:26589949-26589971 CAAAACAAAAAGGCGGGGTGGGG - Intergenic
1066206570 10:33195225-33195247 CTAAACAAGCAGAGGTGCTCAGG + Intronic
1067224148 10:44364458-44364480 AGAAACAAACAGATGTGGTCAGG + Intergenic
1067434843 10:46269681-46269703 CAAACAAAAAACAGGTGGTGAGG - Intergenic
1067479644 10:46586548-46586570 AAAAAAAAAAAGAGGTTGGCTGG + Intronic
1067615092 10:47755249-47755271 AAAAAAAAAAAGAGGTTGGCTGG - Intergenic
1067974095 10:51004493-51004515 CAAAACAAAAAACTGTGGGCTGG + Intronic
1068092161 10:52445702-52445724 GAAAAGAAAAAGTGCTGGTCTGG - Intergenic
1068952542 10:62791430-62791452 CAAACCAAAAAGAGGTGAAGCGG - Intergenic
1069007089 10:63329886-63329908 CAAAACAAAAAAACATGCTCAGG - Intronic
1069286059 10:66716841-66716863 CAAAGCAAAAAAACTTGGTCAGG + Intronic
1069376089 10:67794562-67794584 AAAAAAAAAAACAGGTGGCCGGG + Intergenic
1069525213 10:69164214-69164236 CAAAAAAAAAAAAGGTGGAGGGG - Intronic
1070000016 10:72369311-72369333 AAAAAAAAAAAGAGGTGGGCAGG + Intronic
1070264390 10:74887840-74887862 CAAAAAAAAAAAAGGTAGTTTGG + Intronic
1070278202 10:75028605-75028627 CAAAACAAAGAGAGGAAGACCGG + Exonic
1070315017 10:75301534-75301556 CAAAACAAATAGAAATGGCCGGG - Intergenic
1071484199 10:86087579-86087601 GAAAACAGAAAGAGCTGGCCTGG - Intronic
1071612649 10:87045676-87045698 CAAAAAAAAAAGGGGGGGTTGGG - Intergenic
1071630493 10:87215209-87215231 AAAAAAAAAAAGAGGTTGGCTGG - Intergenic
1071771154 10:88730271-88730293 CAAAACAAAAAAAAGCTGTCTGG - Intronic
1072274759 10:93812378-93812400 AAAAACAAAAAAAGGGGGCCAGG + Intergenic
1072895124 10:99359937-99359959 CAAAAAAAAAAGCGGGGGCCGGG + Intronic
1072976061 10:100059599-100059621 AAAAAAAAAAAGAGTTGGTGAGG + Intronic
1074349776 10:112724921-112724943 CAAAACAAAAAGAGGAGAGAAGG - Intronic
1075037714 10:119082942-119082964 CAAAAAAATAAGAGCTGGGCAGG + Intergenic
1075193287 10:120330918-120330940 AAAAAGTAAAATAGGTGGTCAGG - Intergenic
1077547742 11:3183004-3183026 AAAAAAAAAAAGAGGGAGTCTGG - Intergenic
1078220285 11:9346106-9346128 AAAAAAAAAAAGAGATGGCCAGG - Intergenic
1078708491 11:13767854-13767876 CAAAACAAATAGATGTGGTTAGG + Intergenic
1079059386 11:17234699-17234721 AAAAAAAAAAAGAGTTGGCCGGG - Intronic
1079066001 11:17293262-17293284 AAAAAAAAAAAGATGTTGTCAGG + Intronic
1079231908 11:18656319-18656341 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
1079412969 11:20207391-20207413 CACACCAAAAAGAACTGGTCAGG + Intergenic
1080628191 11:34050480-34050502 GAAAAGAAAAAACGGTGGTCAGG - Intergenic
1081757901 11:45557673-45557695 CAAGCCAGAAAGAGGAGGTCAGG - Intergenic
1082041791 11:47691996-47692018 CAAAAAAGAAAGAGGTGATGGGG - Intronic
1082222381 11:49655574-49655596 CAAAGCAAGAAGAGGTTGACCGG + Intergenic
1082742765 11:56929162-56929184 GAAAACAAAAACTGGTTGTCTGG + Intergenic
1082929937 11:58592068-58592090 AAAAAAAAAAAGATGTGCTCAGG - Intronic
1083604338 11:63968866-63968888 GAAAAAAAAAAAAGGTTGTCTGG - Intergenic
1083792181 11:64993062-64993084 TAAAACAAAAGGAGGGGGCCAGG + Intronic
1084508739 11:69588178-69588200 GAAAACAAAAATATGTGATCGGG - Intergenic
1084862126 11:72025971-72025993 TAAAATAAAAAGAGGTTCTCAGG + Intronic
1085118157 11:73948706-73948728 AAAAAAAAAAAGAGTTGGTAAGG + Intergenic
1086446625 11:86877859-86877881 AAAAAAAAAAAGAGGTGGGGTGG + Intronic
1086903930 11:92397566-92397588 GGAAACAAAAATAGCTGGTCTGG - Intronic
1087038446 11:93776033-93776055 CAAAACAAAAAAAACAGGTCAGG + Intronic
1087176641 11:95102374-95102396 AAAAAAAAAAAAAGGTGGGCAGG + Intronic
1087232887 11:95685637-95685659 CAAAACAGCAAGAGGTGCCCAGG + Intergenic
1089371990 11:117967610-117967632 CAAAAAAAAATGAGGTGGGCCGG + Intergenic
1089394281 11:118125399-118125421 GAAAGCAAACACAGGTGGTCAGG - Intergenic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1090020889 11:123127416-123127438 CATTATAAAAAGAGGTGGGCTGG - Intronic
1090141415 11:124267782-124267804 CATATCAAATAGAGCTGGTCAGG + Intergenic
1090784496 11:130037387-130037409 CTAAACATAAAGAGATGGCCGGG + Intergenic
1091349048 11:134878371-134878393 CAAAATAAGAAAAGGAGGTCTGG - Intergenic
1091554071 12:1558964-1558986 CAAAAAAAAAAGTGGGGGTGGGG - Intronic
1091739902 12:2953625-2953647 CAAAAAAAAAAAATGTGGCCAGG - Intergenic
1092199656 12:6572433-6572455 AAAAAAAAAAAGAGGTGGCCAGG + Intronic
1092209726 12:6638485-6638507 CAAAAGAACGAGAGGTGGGCAGG + Intronic
1092570851 12:9719742-9719764 CAAACTAAAAAGAGTTGGTTTGG + Intronic
1092650759 12:10632207-10632229 AAAAACAAAAAAAGGTGGTGGGG + Intronic
1093514573 12:19971399-19971421 CACCACAAAAAGAGCTGGTAGGG + Intergenic
1095556103 12:43506771-43506793 AAAAAAAAAAAAAGGTGGCCAGG - Intronic
1095750958 12:45710622-45710644 CAAAACAAAAATAAGAGTTCTGG - Intergenic
1096122999 12:49100721-49100743 AAAAAAAAAAAGAAGTGGGCTGG - Intronic
1096128275 12:49136153-49136175 CAAAACAAATAGACCTGGCCGGG - Intergenic
1097207514 12:57335483-57335505 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1098213489 12:68191351-68191373 AAAAAAAAAAAGGGCTGGTCAGG - Intergenic
1098679129 12:73328168-73328190 GAAAACAAAAATAGGTTTTCTGG - Intergenic
1100512130 12:95285971-95285993 AAAAAAAAAAAGAAGGGGTCGGG - Intronic
1100792782 12:98148987-98149009 CATAACAAAATGCCGTGGTCTGG + Intergenic
1100801530 12:98236184-98236206 AAAAAAAAAAAAAGGTGGTGGGG + Intergenic
1100958974 12:99941889-99941911 CAAAACAGAAGAAGGTGGACAGG + Intronic
1101289501 12:103353290-103353312 AAAAAAAAAAAGAGGGGGTGGGG + Intronic
1101399213 12:104373410-104373432 AAAAAAAAAAAGAGGTAGGCTGG - Intergenic
1101410380 12:104462942-104462964 CAAAATAAAAAGGGGTGATCAGG + Intronic
1101820009 12:108176339-108176361 CAAAACAGATAGTGGTTGTCAGG - Intronic
1102104279 12:110307213-110307235 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
1102322229 12:111946441-111946463 CAAAACAAAGAGATGGGCTCTGG + Intronic
1102670135 12:114611202-114611224 CAAAACAAAAAGAAATGTCCAGG - Intergenic
1102843176 12:116148064-116148086 AAAAAAAAAAAGAGGGGGGCGGG + Intronic
1103096150 12:118134151-118134173 CATATCAAAAATAGGTCGTCAGG - Intronic
1103319769 12:120085288-120085310 CAAAAAAAAAAGAAGTAGCCAGG + Intronic
1103465605 12:121139724-121139746 AAAAAAAAAAAAAGATGGTCAGG - Intronic
1103621693 12:122190854-122190876 CAAAAAAAAAAAAGGTGGTGTGG + Intronic
1103829059 12:123763858-123763880 AAAAAAAAAAAGAAGTGGCCAGG - Intronic
1103995330 12:124826042-124826064 CTAAAAACAAAGAGGTGGCCGGG + Intronic
1104204000 12:126618469-126618491 CAAAAGATAAGGAGGTGGACAGG + Intergenic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1105402748 13:20110122-20110144 CAAAAAAAAAAAAGGAGGCCAGG - Intergenic
1105545079 13:21345232-21345254 CAAACCAAAAAAAGGTTGCCCGG - Intergenic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1105691759 13:22848045-22848067 CAAAACAAAAAGATGTCCACAGG - Intergenic
1106046554 13:26147303-26147325 AAAAACAAAGAGAGGTGATGGGG + Intronic
1106621252 13:31373153-31373175 CAAAATGACTAGAGGTGGTCAGG + Intergenic
1107859024 13:44643160-44643182 AAAAACAAAAAGATGAGGCCAGG - Intergenic
1109171722 13:59106046-59106068 CAAAACAAAAACAAATAGTCAGG - Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1109625638 13:64970301-64970323 TAAAACAAAATGAGGTGGAATGG - Intergenic
1110077556 13:71267796-71267818 CAAAACAAAAGGAGGTGGGGGGG + Intergenic
1110665148 13:78108113-78108135 AGAATCAAAGAGAGGTGGTCTGG - Intergenic
1110695944 13:78489020-78489042 GAAAACAAAAAGGAATGGTCAGG + Intergenic
1110859801 13:80335711-80335733 CAAAAAAAAAAAAGGGGGTGGGG + Intergenic
1111622765 13:90745679-90745701 CAATATAAAAAGAGGTGGTCAGG - Intergenic
1112982763 13:105406946-105406968 TAAAAAAAAAAGAGGCGGTAGGG + Intergenic
1113486820 13:110659488-110659510 CAAAAAAAAAAAAGGAGATCTGG - Intronic
1114321648 14:21551623-21551645 CAAAACAAAAACCGGTAGGCTGG + Intergenic
1114593804 14:23893902-23893924 AAAAAAAAAATGAGGTGATCTGG + Intergenic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1115213600 14:30992581-30992603 AAAAAAAAAAAGATGGGGTCGGG + Intronic
1115324310 14:32121166-32121188 CAAAACCAAAAAAGGTGGCTGGG - Intronic
1115568047 14:34641748-34641770 CAAGAAAAAAAGAGGAGGTGGGG + Intergenic
1115618038 14:35114999-35115021 AAAAACAAAAAGATGGGGTGTGG + Intronic
1116022232 14:39475042-39475064 CAAAACAACAATATGTGGACAGG - Intergenic
1116037237 14:39642009-39642031 CAAAAAAAAAAGGGGGGGTGGGG - Intergenic
1116424917 14:44779178-44779200 CAAAGCCAAAAGAGGAGGACTGG + Intergenic
1118610538 14:67536121-67536143 CAATACCAAAAGAAGTGGTCAGG - Intronic
1118754056 14:68825345-68825367 CAAATGAAAAAGGGGTGGCCAGG + Intergenic
1119989787 14:79183320-79183342 CGAAACAGAAAGATGTGGTTGGG - Intronic
1120116194 14:80620145-80620167 CAAAACAAAAACAAGTGCACTGG + Intronic
1120307968 14:82794827-82794849 AAAAACAAAAAAAGGAGGCCAGG - Intergenic
1120824700 14:88944906-88944928 CTAGACAAAAACAGGTGGTTGGG + Intergenic
1121262014 14:92573273-92573295 CAAAACAAAATAAGGGGGTGAGG + Intronic
1121347098 14:93144239-93144261 CAAAACAAAAAGAAGGGGGTTGG + Intergenic
1122622508 14:103067879-103067901 AAAAACAAAAAGGGCTGGCCAGG + Intergenic
1122739682 14:103864854-103864876 CAAAAAAAAAAAAGGGGGCCGGG - Intergenic
1123193616 14:106595235-106595257 CAAAACCAAACAAGGTGGTAAGG - Intergenic
1123202242 14:106677455-106677477 CAAAACCAAACAAGGTGGTAAGG - Intergenic
1123461501 15:20476448-20476470 GAAAACAAAAAGTGTTGGTGAGG + Intergenic
1123470918 15:20551405-20551427 AAAAAAAAAAAGAGCTGGGCAGG - Intergenic
1123656557 15:22523933-22523955 GAAAACAAAAAGTGTTGGTGAGG - Intergenic
1124272153 15:28292411-28292433 GAAAACAAAAAGTGTTGGTGAGG + Intronic
1124310468 15:28619110-28619132 GAAAACAAAAAGTGTTGGTGAGG - Intergenic
1125009160 15:34851683-34851705 CATAACCAATAGAGGTGGTCTGG - Intergenic
1125203324 15:37122294-37122316 AAAAGCAAAAAGAGATGGCCGGG + Intergenic
1125947828 15:43724344-43724366 AAAAAAAAAAAGAGCTGGACTGG - Intergenic
1127146808 15:56033265-56033287 CAAAAAAAAAAAAAGTGTTCAGG - Intergenic
1127887888 15:63219439-63219461 AAAAAAAAAAAAAGTTGGTCTGG - Intronic
1127973606 15:63981095-63981117 AAAAAAAAAAAGAGGTGATTGGG + Intronic
1128275323 15:66348693-66348715 CAAAAAAAAAAAAGTTGGCCAGG + Intronic
1128500478 15:68223747-68223769 AAAAAAAAAAAGAGGGGGGCTGG + Intronic
1128616174 15:69111727-69111749 CAAAAAAAAGAGAGGAGATCAGG + Intergenic
1128933698 15:71727769-71727791 CAAAAAAAAAAGGGGAGGGCTGG + Intronic
1129045984 15:72734623-72734645 TAAAACAAAAACAGCTGCTCTGG - Intronic
1129375568 15:75128399-75128421 CAAAACAAAAAGAGACGGAGGGG + Intergenic
1129750091 15:78056675-78056697 AAAAAAAAAAAGAGGAGGACTGG - Intronic
1129789150 15:78329137-78329159 CAAATCAAAATGAGGTCGTCAGG - Intergenic
1129972166 15:79788384-79788406 CAAGAAAAAAAAAGGTGGCCGGG + Intergenic
1130175833 15:81569769-81569791 CCATACAAAAAGAGGGGGTTCGG - Intergenic
1130228335 15:82076952-82076974 CAAATCATTAAGAGGAGGTCTGG + Intergenic
1130626800 15:85523806-85523828 AAAAACAAAAAAAGGGGGGCGGG - Intronic
1131640749 15:94290290-94290312 CAAAACAAATGCAGGTGATCTGG + Intronic
1132418024 15:101638289-101638311 CAAAAAAAAAAAAGGTGGGGGGG - Intronic
1132571249 16:645252-645274 AAAAACAAACAAAGGTGGCCGGG - Intronic
1132631201 16:918517-918539 CAAAAGACAAAGAAATGGTCAGG - Intronic
1132831574 16:1930649-1930671 AAAAAAAAAAAGATGTGGTAGGG - Intergenic
1132928242 16:2444593-2444615 CAAAAAAAAAAAAGGTGGCTGGG - Intronic
1133148593 16:3809174-3809196 CAAAAAAAAAAAAGGTGGTTGGG - Intronic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1133528359 16:6628545-6628567 AAAAACAAAATGAGGTGGATTGG - Intronic
1133750022 16:8717810-8717832 AAAAAAAAAAAGAGGTGATTTGG - Intronic
1134245547 16:12536987-12537009 TAAAATAAAAAGAGTTGTTCAGG + Intronic
1134602164 16:15542051-15542073 AAAAAAAAAGACAGGTGGTCGGG - Intronic
1134689490 16:16181950-16181972 CAAAACCACAAGTGGTGGGCTGG + Intronic
1135053859 16:19214320-19214342 CAAAACAAAAAAAGCTGACCAGG - Intronic
1135260241 16:20974331-20974353 CAAAACAAAACAAAGTGGCCAGG - Intronic
1135616740 16:23917370-23917392 TAAAACAGAATGAGGTGGCCGGG - Intronic
1135973120 16:27086792-27086814 AAAAATAAAATAAGGTGGTCAGG - Intergenic
1135981922 16:27154426-27154448 CAAAAACAAAAAAGGAGGTCAGG + Intergenic
1136341761 16:29648595-29648617 AAAAAAAAAAAGAGCTGGGCGGG - Intergenic
1136355529 16:29742950-29742972 AAAAACAAAAAAAAGTGGCCGGG + Exonic
1137069409 16:35888254-35888276 TAAAAATACAAGAGGTGGTCAGG + Intergenic
1139543325 16:67635313-67635335 CAAAAAAACAAAAGGTGGCCAGG - Intronic
1139585335 16:67899322-67899344 AAAAAAAAAAAAATGTGGTCTGG - Intronic
1139586470 16:67907256-67907278 AAAAAAAAAAAGAGTTGGCCAGG - Intronic
1140233019 16:73133453-73133475 CAAAAAAAAAAGAGGTCATTAGG + Intronic
1140467204 16:75192074-75192096 AAAAAAAAAAAGATGTGATCTGG - Intergenic
1140869269 16:79091748-79091770 GAAAAGAAAAAGATGCGGTCGGG - Intronic
1141800295 16:86303574-86303596 CAAAAGAAAAAAAGGGGGGCGGG + Intergenic
1141866724 16:86755440-86755462 CAAAACCAAAAAATGTGGTGAGG + Intergenic
1142013865 16:87733310-87733332 CAAAACAGACAGGGGTGGTGAGG + Intronic
1142886358 17:2914783-2914805 AAAAAAAAAAAGAAGTGGCCGGG - Intronic
1142903773 17:3029091-3029113 CAAAACAAAAACACCAGGTCAGG - Intronic
1143131272 17:4679023-4679045 CAAAAAAAAAAAAGGTCATCTGG - Intronic
1143177033 17:4961458-4961480 AAAAAAAAAAAGAGATGGCCGGG + Intronic
1143650691 17:8262795-8262817 CAAAAAAAAAAAAGCTGGTCAGG + Intronic
1143886161 17:10066483-10066505 CAAAACAAAAAAAAGTAGTCTGG - Intronic
1143901616 17:10178693-10178715 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
1143967072 17:10763274-10763296 CAAAACAAAAAAAGCTGGTGTGG - Intergenic
1144122709 17:12171509-12171531 CAAAACAGAAATAAGTGGTTGGG - Intergenic
1144216083 17:13056879-13056901 CAAAACAAAAAAAGCTGATTTGG - Intergenic
1144822694 17:18086653-18086675 AAAAAAAAAAAAAGGTGGTATGG + Intergenic
1146286755 17:31579218-31579240 CAAAACAAAAAGAGATGGAAAGG + Intergenic
1146586013 17:34082329-34082351 CAAAATAAAAGGTGGTGGCCTGG - Intronic
1147288682 17:39423878-39423900 CAAAAAAAAAAAAGGTGTTTGGG - Intronic
1147337186 17:39734225-39734247 AAAAAAAAAAAGAAGGGGTCAGG - Intergenic
1147402077 17:40186599-40186621 AAAAAAAAAAAGAGGTGGGCTGG + Intronic
1147665981 17:42148416-42148438 AAAAAAAAAAAGAAGTGGGCAGG + Intronic
1147746765 17:42699430-42699452 CAAAACAAAAGGAGGGGGGCAGG - Exonic
1148030693 17:44618722-44618744 CAAAACTATAATAGGTGGCCAGG + Intergenic
1148412789 17:47482269-47482291 CAAAAAAAAAAAAGGGGGCCGGG + Intergenic
1148625742 17:49067696-49067718 CAAAACAAAAAAAAATGCTCTGG - Intergenic
1148629602 17:49096936-49096958 AAAAAAAAAAAAAGGTGGCCGGG - Intergenic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1150578213 17:66448987-66449009 AAAAAAAAAAAAAGGTGGCCAGG + Intronic
1150870833 17:68909507-68909529 CAAAATAAAAAGTGCTAGTCAGG - Intronic
1150985008 17:70185965-70185987 GATAATAAAAAGAGGTGGACAGG + Intergenic
1151172464 17:72258722-72258744 CAAAACAAAAACAGATGCTCTGG + Intergenic
1151337666 17:73449591-73449613 AAAAAAAAAAAGAGGTGGGGGGG - Intronic
1151536455 17:74741593-74741615 AAAAAAAAAAAGAGCTGGGCTGG + Intronic
1151562687 17:74879029-74879051 AAAAAAAAAAAAAGGTGGTGAGG - Intronic
1152022568 17:77788349-77788371 AAAAAAAAAAAGAGGGAGTCGGG + Intergenic
1153227938 18:2912021-2912043 AAAAAAAAAAAGTGGTTGTCAGG - Intronic
1153639104 18:7139415-7139437 CAAAAAAAAAAGGGGTGGTGGGG + Intergenic
1153748964 18:8210007-8210029 AAAAAAAAAAAAAGGTGCTCGGG + Intronic
1153861949 18:9220430-9220452 CAAAACAAGAAGAGATGGTAAGG + Intronic
1154298061 18:13167625-13167647 CAAAACAAAACAAGGTATTCAGG + Intergenic
1154409938 18:14133412-14133434 ACAAAAAAAAAGAGGTGTTCAGG - Intergenic
1155092952 18:22528909-22528931 AAAAACAGAAAGTGGTGATCAGG - Intergenic
1155146657 18:23089427-23089449 AAAAAAAAAAAGAGTTGGTGGGG + Intergenic
1155333289 18:24739691-24739713 TAAAACAAAGAGAGGTTGTTTGG - Intergenic
1155682287 18:28503046-28503068 CAAAACAAAAACAGGAGTCCTGG - Intergenic
1155856021 18:30835607-30835629 CAAAACAAAAAGAAGTAGGGTGG + Intergenic
1157008887 18:43621998-43622020 TAAAACCAGATGAGGTGGTCAGG + Intergenic
1158095253 18:53763135-53763157 GAAAATAAAAAGAAGTGATCAGG + Intergenic
1159361770 18:67414684-67414706 CAAAAAAAAAAAAAATGGTCAGG - Intergenic
1160755021 19:752523-752545 CAAAAAAAAAAGCGGGGGGCGGG + Intronic
1161002142 19:1915946-1915968 AAAAAAAAAAAGAGATGGTCCGG + Intronic
1161506954 19:4649223-4649245 CAAAAAAAAAAAAGCTGGCCGGG - Intronic
1161542068 19:4857977-4857999 AAAAAAAAAAAGAGGGGGCCGGG + Intronic
1161992741 19:7694202-7694224 TAAAACAGGAAGAGGTGGCCAGG + Intronic
1162089945 19:8272788-8272810 AAAAAAAAAAAGAGGAGGCCAGG + Intronic
1162203068 19:9035253-9035275 AAAAACAAAAAGAGGTTGGAAGG + Intergenic
1162251908 19:9452079-9452101 CAAAAAAAAAAGTGGGGGGCAGG + Intergenic
1162576621 19:11503033-11503055 CAAAAAAAAAAAAGGTGGGGGGG + Intronic
1162970536 19:14178504-14178526 CAATAAAAAAAGAGGGGGTGGGG + Intronic
1163278960 19:16303446-16303468 AAAAAAAAAAAAAGGTGGTAGGG - Intergenic
1163550386 19:17963306-17963328 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1163574444 19:18102472-18102494 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1163592292 19:18200934-18200956 CAAAAAACAAACAGGGGGTCGGG + Intronic
1163610474 19:18298618-18298640 CAAAAAAAACTGAGGTGGTTGGG - Intergenic
1163679606 19:18673074-18673096 CAAAAAAAAAAAAGCTCGTCAGG + Intergenic
1163682726 19:18692607-18692629 AAAAAAAAAAAGAAGTGGTTAGG + Intronic
1163918607 19:20266029-20266051 AAAAAAAAAAAAAGGTGGCCAGG - Intergenic
1164069032 19:21749195-21749217 TGAAACACAAAGAGGAGGTCCGG - Intronic
1164119205 19:22250573-22250595 CAAACAAAAAACAGGTGGGCAGG - Intergenic
1164150419 19:22545689-22545711 CAAAAAAAAAAGGGGGGGTAGGG + Intergenic
1164936234 19:32216693-32216715 AAAAAAAAAAAGACATGGTCTGG + Intergenic
1165170654 19:33889535-33889557 CAAAAAAAAAAAAGGCGGGCGGG - Intergenic
1165216664 19:34279286-34279308 CAAAACAAAAAGTGCTGGCAAGG - Intronic
1165360690 19:35335089-35335111 AAAAAAAAAAAGAGGTGGTGAGG + Intronic
1165480853 19:36063236-36063258 AAAAACAAAAAAAAGTGGCCAGG - Intronic
1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG + Intronic
1166050172 19:40254530-40254552 AAAAAAAAAAAAAGGGGGTCAGG + Intronic
1166073742 19:40401758-40401780 AAAAAAAAAAAGGGGTGGGCTGG - Intronic
1166533705 19:43558334-43558356 CAAAAAAAAAAGAGTAGGCCAGG + Intronic
1166822096 19:45586882-45586904 CAAAACAAAAAAAATTGGCCGGG + Intronic
1166866503 19:45841288-45841310 CAAAAAAAAAAAAGGTGGGGGGG - Intronic
1167075475 19:47246042-47246064 CAAAAAAAAAAAAGGGGGCCAGG - Intergenic
1167385646 19:49161624-49161646 AAAAAAAAAAAGAGGTAGCCGGG - Intronic
1168226314 19:54997748-54997770 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
1168442832 19:56385677-56385699 AAAAAAAAAAAGAGTTGGTGTGG + Intronic
925317580 2:2937696-2937718 CAAAACAAAAAGCTATGGCCAGG + Intergenic
926183756 2:10670778-10670800 CAAAACAAAAAGACATGGGTAGG + Intronic
926856500 2:17262125-17262147 CAAAAAAAAAAAAAGTGTTCTGG - Intergenic
926950570 2:18238413-18238435 CAAAACAAAAGAAAGTGTTCAGG - Intronic
927169656 2:20358155-20358177 CAAAACAAAAAGGGTTAGTGAGG - Intergenic
927444965 2:23151660-23151682 CAAAACAAAAAAATGTAGCCAGG + Intergenic
927890529 2:26745326-26745348 TAAAACAAAAAGAGGTGCTGAGG - Intergenic
928040258 2:27868628-27868650 CAAAACAAGAAGTGGTGGAAAGG - Intronic
928147612 2:28793736-28793758 CAAAACAAAACAGGGTGGTTTGG + Intronic
928285241 2:29984747-29984769 AAAAAAAAAAAGAGGGGGGCGGG - Intergenic
928448316 2:31353014-31353036 AAAAAAAAAAAGAGGTGGCTGGG - Intronic
928632901 2:33212372-33212394 TAAGACAAAAGGAGGTGGTTAGG + Intronic
929172913 2:38949280-38949302 CAAACAGAAAAGAGATGGTCTGG - Intronic
929200267 2:39227878-39227900 CTAAAGAAAAACAGGTGGTAAGG + Intronic
929215610 2:39408641-39408663 AAAAAAAAAAAAAGGTGGTGGGG + Intronic
929473085 2:42216219-42216241 AAAAAAAAAAAGAAGTGGGCCGG - Intronic
929534899 2:42775257-42775279 AAAAAAAAAAAAAGGTTGTCTGG + Intronic
929722505 2:44384740-44384762 CAAAACAAAAAGTGGGGGAAAGG - Intronic
929901644 2:46008737-46008759 CTAAATAAAAAGAGGTCCTCTGG + Intronic
930393267 2:50788089-50788111 CAAAAAAAAAAAAGGTGGCGAGG - Intronic
930505613 2:52279893-52279915 AAAAATAAAAAAAGGTAGTCTGG + Intergenic
930574124 2:53125648-53125670 CAAAACAAAACAAGGTATTCAGG - Intergenic
931784491 2:65607209-65607231 AAAAAAAAAAAGAGCTGGTGGGG + Intergenic
931922395 2:67035314-67035336 CAAAAAAAAAAAAGGGGGACCGG - Intergenic
932797439 2:74709006-74709028 AAACACAAAAAGAGCTGGTGTGG + Intergenic
932858666 2:75266250-75266272 CACAACAGAAAGAGGAGGTGGGG - Intergenic
934055291 2:88246431-88246453 CTATACAAAAACAGGTGGTGGGG - Intergenic
934076319 2:88431638-88431660 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
934750770 2:96792804-96792826 AAAAAAAAAGAGAGGAGGTCAGG + Intronic
935373419 2:102371034-102371056 AACAACAAAAAAAGGTGATCTGG - Intronic
935930175 2:108115695-108115717 CAAAACAAAAGGCTGTGCTCAGG + Intergenic
935930346 2:108117500-108117522 CAAAACAAAAGGCTGTGCTCAGG + Intergenic
935958009 2:108397903-108397925 ACACACAAAAAGAGGTGGTGTGG - Intergenic
936713968 2:115162756-115162778 CAAAACAAAAAGGGGTTGGCGGG - Intronic
936771170 2:115915174-115915196 CAAAACAAAGAGATGGGCTCTGG - Intergenic
937680341 2:124637255-124637277 AAAAGCAAAAAGAAGGGGTCAGG - Intronic
937779150 2:125817438-125817460 TAGAGCAAAAATAGGTGGTCTGG + Intergenic
938012256 2:127838249-127838271 AACAACAAAAAGATGTGGGCTGG - Intergenic
938017121 2:127876356-127876378 AAAAAAAAAAAAAGGTGGTAGGG + Intronic
938033802 2:128018800-128018822 AAAAAAAAAAAAAGGTGGTTGGG + Intronic
938424347 2:131172169-131172191 CAAAAAAAAAAAAGGGGGGCCGG - Intronic
939442310 2:142264751-142264773 CAAAACAAAAAAAAGAGGCCTGG - Intergenic
939990022 2:148869075-148869097 AAAACCAAAAAGAGGTGTTTTGG - Intergenic
940952663 2:159693701-159693723 AAAAAAAAAAAAAGATGGTCAGG - Intergenic
941082716 2:161080477-161080499 GAAAAAAAAAAGAGGTGATTAGG - Intergenic
941305214 2:163856317-163856339 CAAAAAAAAATGAGCTGGGCCGG - Intergenic
941940792 2:171035341-171035363 CAAAAAAAAAAAAGGGGGTTGGG + Intronic
943255159 2:185585287-185585309 CAAAACAAAGGGATGTGCTCTGG + Intergenic
944186714 2:196956847-196956869 AAAAAAAAAAAAAAGTGGTCAGG - Intergenic
944395359 2:199260472-199260494 AAAAACAGACAGAGGTGCTCAGG - Intergenic
944546292 2:200802263-200802285 CAAAATAAAAAGTGTTGGCCAGG + Intergenic
945735448 2:213593735-213593757 AAAAAAAAAAAGATGTGGTGGGG - Intronic
945876444 2:215282988-215283010 TAAAACAAAAAGTGGGGGCCGGG + Intergenic
946583141 2:221152785-221152807 CAATAAAAAAAAAGGGGGTCTGG - Intergenic
946689915 2:222302068-222302090 AAAAAAAAAAAAAGGTGGGCGGG + Intronic
946754797 2:222933140-222933162 CAAAACAAAGAAAGGTGGAGAGG - Intronic
946837487 2:223786912-223786934 CAAAAAAAAAAGAAGTGATATGG + Intronic
946850288 2:223899368-223899390 CAATAAAAAAAGAGCTGGTAGGG + Intronic
946977298 2:225167485-225167507 GGAAACAATAAGAGGTGGTATGG + Intergenic
947211566 2:227713413-227713435 AAAAAAAAAAAGAGGGGGTGGGG + Intronic
947372254 2:229459860-229459882 CAAAACAAAAAAAAGAGGCCGGG + Intronic
947867038 2:233405535-233405557 AGAAAAAAAAAGAGGTGATCAGG + Intronic
947915036 2:233826216-233826238 AGAAATACAAAGAGGTGGTCGGG - Intronic
948249035 2:236510787-236510809 CAAAAAAAAAAAAGTTGGTGGGG - Intergenic
1169094099 20:2881010-2881032 AAAAAAAAAAAGAGGAGGACCGG + Intronic
1169169378 20:3452232-3452254 ACAAACAAAAAAAGGTGGTGGGG + Intergenic
1169370183 20:5022738-5022760 AACATCAAAAAGAGGTGGCCTGG - Intergenic
1169449288 20:5697504-5697526 AAAAAAAAAAAAAGGTGGGCGGG + Intergenic
1170022974 20:11856188-11856210 AAAAAAAAAAAAAGGTGGCCAGG + Intergenic
1170489295 20:16855799-16855821 CAAAACAAAACAAGGTATTCAGG - Intergenic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1171477962 20:25428166-25428188 CAAAACAAAAAAAATTGGCCGGG - Intronic
1172423167 20:34834974-34834996 AAAAAAAAAAAGCGGTGGTGGGG + Intergenic
1172595267 20:36146849-36146871 AAAAAAAAAAAAAGGAGGTCAGG + Intronic
1173331674 20:42080566-42080588 CAGAACAAAAGCAGGTGGTCTGG + Exonic
1173780618 20:45753723-45753745 AAAAAAAAAAAAAGGTGGTGGGG + Intronic
1174016480 20:47492639-47492661 CAAAACAAAAAACTGGGGTCAGG + Intergenic
1174209409 20:48865540-48865562 AGAAACAAAAAGAGGTGGGCAGG + Intergenic
1175057884 20:56214622-56214644 AAAAAAAAAAAAAGGTGGTGGGG + Intergenic
1175066078 20:56290007-56290029 AAAAAAAAGAAGAGGTGGGCAGG - Intergenic
1175076586 20:56380059-56380081 TAAAACAAAAAGAGCAGGCCGGG + Intronic
1176164726 20:63666823-63666845 AAAAAAAAAAAGAGCTGGCCAGG - Intronic
1176296133 21:5074301-5074323 CAAAACAAAAAAAGGTGGTGGGG + Intergenic
1176895391 21:14372231-14372253 AAAAACAAAAAAAGGTGATCAGG + Exonic
1177091567 21:16775695-16775717 TAAAGAAAAAAGAGGTGGACAGG - Intergenic
1177287930 21:19075960-19075982 CAAAGCATTAAGAGGTAGTCTGG + Intergenic
1177622435 21:23613499-23613521 CAAAAGAAAAAGATGAGTTCAGG - Intergenic
1177847986 21:26313739-26313761 AAAAACAAAAAAAGGTGGAGAGG + Intergenic
1178294210 21:31395239-31395261 AAAAAAAAAAAGAGGAGGTGGGG + Intronic
1179072195 21:38082115-38082137 CAAAACAAAAGGCGGTGGGTGGG - Intronic
1179860916 21:44187820-44187842 CAAAACAAAAAAAGGTGGTGGGG - Intergenic
1180571396 22:16724684-16724706 CAAAAAAAAAAAAGGTGGAAAGG + Intergenic
1181568956 22:23756617-23756639 AAAAAGAAAAAGAGTTGGCCAGG - Intergenic
1181597772 22:23928307-23928329 CAAAACAAAAACAGGGAGTGTGG + Intergenic
1181748800 22:24974674-24974696 AAAAAAAAAAAGAGGTGAGCTGG - Intronic
1182252474 22:29012011-29012033 CAAAACAAAAAGGCCTGGTCTGG + Intronic
1182744390 22:32594459-32594481 CAAAACAAAAGGAATGGGTCAGG - Intronic
1182975661 22:34621852-34621874 AAAAACACCAAGAGGGGGTCAGG + Intergenic
1183060081 22:35331084-35331106 AAAAAAAAAAAAAGGTGGACAGG - Intronic
1183271407 22:36864851-36864873 CAAGCCAAAAAGAGGTGGAAGGG - Intronic
1183910560 22:41075807-41075829 AAAAAAAAAAAGAGGTGGGGTGG + Intergenic
1184795553 22:46730420-46730442 CAAAAAAAAAAGAAGTTTTCAGG + Intronic
950743181 3:15065687-15065709 CAAAAGAAAAAAAGATGGTTTGG + Intergenic
951216155 3:20027171-20027193 TAAAACAACAAGAGTTGGCCAGG - Intergenic
951563148 3:23987973-23987995 AAAAACAAAAAGAACTGGCCGGG - Intergenic
951695670 3:25443410-25443432 CCAAAAAAAAAGGGGTGGTGGGG - Intronic
952409389 3:33033785-33033807 AAAAAAAAAAAAAGGTGGTAAGG + Intronic
952846269 3:37690416-37690438 CAAAACAGAATGAGGTGGGGAGG - Intronic
953740301 3:45532935-45532957 CACAGTAAAAAGAGGTGGCCGGG - Intronic
954166212 3:48760379-48760401 CAAAACACAAAAATGTAGTCAGG + Intronic
955455473 3:59116533-59116555 AAAAAAAAAAAGAAGTGGACTGG - Intergenic
955557460 3:60153376-60153398 AAAAAAAAAAAGAGGAGGTGGGG + Intronic
955681917 3:61510898-61510920 GGAAACAAAAAGATGTAGTCAGG + Intergenic
956170979 3:66433010-66433032 AAATATAAATAGAGGTGGTCTGG - Intronic
956176187 3:66475380-66475402 CCAAACAAAAGGTGGTGGTTGGG + Intronic
956479911 3:69662945-69662967 AAAAGAAAAAAGAGATGGTCTGG + Intergenic
957053069 3:75425161-75425183 AAAAAAAAAAAAAGGTGGGCGGG + Intergenic
957187988 3:76967500-76967522 AAAAAAAAAAAGAGCTGGCCAGG - Intronic
957755978 3:84488273-84488295 AAAAAAAAAAAAAGGGGGTCGGG - Intergenic
958489477 3:94753538-94753560 CAAACTAAAAAGATGTGGCCGGG - Intergenic
959414565 3:106068263-106068285 AAAAACCAAAAAAGGTGGTGGGG + Intergenic
959849344 3:111070281-111070303 GAAAGAAAAAAGAGGTGGGCAGG + Intronic
960120241 3:113941912-113941934 CAAAAAAAAAAAAGATGGCCGGG - Intronic
960525444 3:118704845-118704867 CGAAACAAGAAGAGGTGGGGAGG - Intergenic
960540390 3:118855127-118855149 AAAAAAAAAAAGAGGTGTACTGG + Intergenic
960589473 3:119351613-119351635 AAAAAAAAAGAGAGGTGGCCTGG + Intronic
961505335 3:127367326-127367348 GAAAAAAAAAAAAGGTGGGCTGG + Intergenic
961721550 3:128900225-128900247 CAAACCAAAAAAAAGTGGCCAGG - Intronic
962145035 3:132831897-132831919 AAAAAAAAAAAGAGTTTGTCTGG + Intergenic
962274896 3:134004666-134004688 CAAAACAAAAAAAGGTGAAAAGG + Intronic
962332285 3:134488610-134488632 AAAAACAAAAAAAAGTGGTTTGG + Intronic
962341756 3:134591718-134591740 AAAAACAAAAAAAATTGGTCGGG + Intergenic
962515184 3:136143491-136143513 AAAAACAAAAAGATGTTGACTGG + Intronic
962528860 3:136260045-136260067 CAAAACAAAAAAAGTTGCCCGGG - Intronic
963510075 3:146235950-146235972 CAAAACATCAAGATGTGGCCTGG + Intronic
963678323 3:148342822-148342844 CAAGAGAAAAAGAAGTGATCTGG + Intergenic
963741640 3:149087084-149087106 AATAACAAAAAGAGGTGGGGAGG - Intergenic
964263205 3:154864233-154864255 TAAAACAAAAACTGGTAGTCAGG + Intergenic
964393544 3:156222015-156222037 CAAAACAAAACAAGGTATTCAGG + Intronic
964450587 3:156809267-156809289 CAAAAAAAAAAAAAGTGATCTGG - Intergenic
965875492 3:173313282-173313304 CTAACCAAAAACAGATGGTCTGG + Intergenic
965961638 3:174436140-174436162 CAAAATAAAAAGTGTTGGTGAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966926519 3:184647981-184648003 AAAAAAAAAAAAAGGTGGTGAGG - Intronic
966961266 3:184941670-184941692 CCACAGAAAAAGAGGTGGGCAGG - Intronic
967447968 3:189589151-189589173 CAAAATAAAAAGAGGTCTTGTGG - Intergenic
967815598 3:193795847-193795869 AAAAAAAAAAAGAGGGGGTCAGG - Intergenic
967987625 3:195107176-195107198 CAAAAAGAAGAGAGGTGGCCGGG + Intronic
968006005 3:195243360-195243382 AAAAAAAAAAAGAGATGGTTCGG + Intronic
968219595 3:196926630-196926652 AAAAAAAAAAAAAGGTGGACTGG - Intronic
968620245 4:1600640-1600662 GAAAAAGAAAAGAAGTGGTCAGG - Intergenic
968722516 4:2218134-2218156 AAAAATAAAAAAAGGTGGCCAGG + Intronic
969294192 4:6259799-6259821 AAAAAAAAAAAGAGTGGGTCAGG + Intergenic
969416785 4:7065845-7065867 AAAAAAAAAAAGAGGTCCTCTGG - Intronic
970314308 4:14814915-14814937 TGATACAAAAAGAGCTGGTCAGG - Intergenic
971005017 4:22363812-22363834 CAAAACAAAAAAAGGTGGAGTGG + Intronic
971015497 4:22485078-22485100 CAAAAAAAAAAGTGCTGGTGTGG - Intronic
971121097 4:23705913-23705935 CAAAACAAAAAGAGGCTGCACGG + Intergenic
971215275 4:24656840-24656862 CAAAACAAAAACTGGGGGTGAGG - Intergenic
972023930 4:34352690-34352712 AAAAAAAAAAAAAGATGGTCTGG - Intergenic
972441536 4:39098560-39098582 CAAAAAAAAAAGTTGTGGCCCGG - Intronic
972698833 4:41474191-41474213 AAAAACAAAAATGGGTGGTCAGG + Intronic
974087696 4:57278822-57278844 CAACTCAAAAAGAGGCTGTCAGG - Intergenic
975860032 4:78667233-78667255 CAAAATTAAAAGAGGATGTCAGG + Intergenic
975940277 4:79635659-79635681 AAAAAAAAAAAGAGGGGGTGGGG - Intergenic
976022190 4:80642468-80642490 TAAAACAAAAATAGTTGGCCAGG + Intronic
976083342 4:81380746-81380768 CAAAACAGTAAGAGGTGGCCTGG + Intergenic
976619756 4:87115598-87115620 AAAAAAAAAAAGAGGTGGGTTGG - Intronic
976772527 4:88669215-88669237 CAAAAAATAAAAAGGTGGTGAGG - Intronic
978805887 4:112799812-112799834 AAAAAAAAAAAGAGGTGGGCTGG - Intergenic
979526483 4:121722797-121722819 CAAAACAAAAAGAAGTGAAATGG + Intergenic
980513153 4:133820373-133820395 CAAAAAAAAAAAAAGTAGTCGGG + Intergenic
981706543 4:147665133-147665155 AAAAAAAAAAAGATGTTGTCTGG + Intronic
982508475 4:156250658-156250680 AAAAAAAAAAAAAGGTGGTCAGG - Intergenic
982715237 4:158800021-158800043 AACACCAAAAAGAGGTGGCCAGG - Intronic
983044034 4:162964489-162964511 AAAAATAAAAAGAGCTGGCCGGG - Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
984270668 4:177545226-177545248 GAAAACAAACAGAGGTAGGCTGG + Intergenic
984337289 4:178408913-178408935 CAAAAAAAACAGTGGTTGTCAGG + Intergenic
984426905 4:179598802-179598824 CAAGACAAGAACAGGTGGTGGGG - Intergenic
984741942 4:183173345-183173367 CAAAAGAAAAATATGTGGCCAGG - Intronic
984894817 4:184528956-184528978 CAAAAAAAAAAAAGGAGGGCTGG - Intergenic
986503797 5:8429252-8429274 CATAACAAAAAGAGGTAATAAGG - Intergenic
987065843 5:14288798-14288820 GAAAACAAGAAGGGCTGGTCCGG - Intronic
987520148 5:18971441-18971463 AAAAACAAAAAAAGGTTGTATGG + Intergenic
987941822 5:24548469-24548491 AAAAAAAAAAAGAGGAGGACTGG - Intronic
988104595 5:26728085-26728107 CAAAACAAATGGAGGTTGTGGGG - Intergenic
989053502 5:37344497-37344519 AAAAAAAAAAAAAGGTGGCCAGG + Intronic
990265430 5:54070391-54070413 CAAAAAAAAAAAAGTTGGTTTGG + Intronic
991174934 5:63676626-63676648 TAAAAAAAAAAAAGGTGTTCTGG - Intergenic
991276414 5:64852766-64852788 AAAAAAAAAAAAAGGTGGCCGGG - Intronic
991907599 5:71527367-71527389 CAAAATAAAAAGAGTTCGCCAGG - Intronic
992005977 5:72477874-72477896 AAAAAAAAAAAGTGGTGGGCTGG + Intronic
992576311 5:78117163-78117185 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
992645216 5:78805409-78805431 GAAAACAAAATGAGGTTGTTAGG + Intronic
992716612 5:79516728-79516750 CAAAAAAAAACGACGCGGTCGGG - Intergenic
992737653 5:79739685-79739707 CAAAACAATAAGAGGGGGCTGGG + Intronic
992843277 5:80717660-80717682 AAAGACAAAAAGTGTTGGTCAGG - Intronic
993699281 5:91099267-91099289 CAAAAAAAAAAAAAGTGTTCGGG + Intronic
994017349 5:94982901-94982923 AAAAAAAAAAAAAGATGGTCAGG + Intronic
994748836 5:103713115-103713137 AAAAAAAAAAAAAGGTGCTCTGG - Intergenic
995383358 5:111561610-111561632 CAAAACAAAACACGGTTGTCTGG + Intergenic
995655479 5:114421593-114421615 CAAAACAAAAACAGATGCTGGGG - Intronic
996547471 5:124695610-124695632 CAAAAAAAAATGAGCTGGTGTGG + Intronic
996627144 5:125584101-125584123 CATAACAAAAGGAGGTAGTTAGG + Intergenic
996703949 5:126478147-126478169 AAAAAAAAAAAAAGGAGGTCAGG + Intronic
996801646 5:127410118-127410140 CAAAACAAAAATAGGAGCTTAGG - Intronic
997879355 5:137575504-137575526 AACAACAAAAAAATGTGGTCAGG + Intronic
998423345 5:142006812-142006834 CAAAAAAAAAAAAGTTGATCTGG - Intronic
999078694 5:148822968-148822990 CAAAAAAAAAACAGGAAGTCAGG - Intergenic
999694974 5:154180639-154180661 CAAAACACAGAGAGGTGGTGGGG - Intronic
1000080395 5:157839927-157839949 AAAAGAAAAAAGAGGAGGTCGGG + Intronic
1000248562 5:159470733-159470755 CAAAACAAAAAGAGTTTGAGAGG - Intergenic
1000442670 5:161282066-161282088 CAAAACCAAGTGAGGTGGTAAGG + Intergenic
1000687970 5:164276286-164276308 CAAATCAAAATGAGCTGGTGAGG + Intergenic
1000810945 5:165860307-165860329 CAAAACAAACAGAGGTGATCAGG + Intergenic
1001507471 5:172291263-172291285 AAAAAAAAAAAAAGGTGGGCGGG - Intergenic
1001825795 5:174743931-174743953 AAAAAAAAAAAAAGGAGGTCAGG + Intergenic
1001827269 5:174755269-174755291 GAAAACAACAAGTGGTGGTAAGG - Intergenic
1002387645 5:178880491-178880513 AAAAAAAAAAAGAGGAGGCCGGG - Intronic
1002548549 5:179969692-179969714 CAAAACATAAAAAAGTGGCCAGG + Intronic
1002670185 5:180860697-180860719 AAAAAGAAAAAAAGGTGGTGGGG + Intronic
1002707557 5:181172753-181172775 CAAAAAACAAAGAACTGGTCTGG - Intergenic
1003364139 6:5456738-5456760 AAAAAAAAAAAGAGATGGGCAGG + Intronic
1003537218 6:6985791-6985813 AAAAAAAAAAAAAGGTGGCCAGG + Intergenic
1003831953 6:10021537-10021559 GAAAAGAAAAAAAGGTGGGCAGG - Intronic
1003880909 6:10478807-10478829 GAAAAAAAAAAGAGATGCTCAGG + Intergenic
1004902726 6:20209009-20209031 CAAAACAAAGTGAGGAGGACAGG + Intronic
1005079753 6:21945016-21945038 CAAAAAAAAAGGAGGTGGGTGGG - Intergenic
1005149495 6:22732643-22732665 CAAAACCAAAAGGAGAGGTCAGG + Intergenic
1005302435 6:24483892-24483914 CAAAACAAAACAAAGTGGTGGGG - Intronic
1005732662 6:28713689-28713711 AAAAAAAAAAAGAGGGGGGCCGG - Intergenic
1005801417 6:29428775-29428797 AAAAAAAAAAAGAGTTGGCCAGG + Intronic
1006138172 6:31909592-31909614 AAAAAAAAAAAGAGGTGGGCGGG - Intronic
1006177403 6:32130725-32130747 AAAAAAAAAAAAAGGTGGGCCGG + Intergenic
1007280431 6:40708388-40708410 CAGAAGAAAAAGAGGTGGAGGGG + Intergenic
1007551800 6:42735607-42735629 CAAAACAAAAAGATCTGGCCAGG + Intergenic
1007623423 6:43228841-43228863 CAAAACAAAAAAAGTTGGTGGGG + Intronic
1007821756 6:44565560-44565582 CAAAACAATGAGAGCTGGACAGG - Intergenic
1007874236 6:45077794-45077816 CAAAACAAAAAGTTGAGGTGTGG - Intronic
1008223643 6:48884458-48884480 GAAAACGAAAAGTGGTGGGCAGG + Intergenic
1008289944 6:49703259-49703281 CAAAACAAAAAGAACAAGTCTGG - Intronic
1008335746 6:50302631-50302653 CTAAGCAAAAAGAAATGGTCTGG - Intergenic
1008442343 6:51546233-51546255 CAAAAAAAAAAAATGTGGTTTGG + Intergenic
1009029046 6:58035089-58035111 AGAAACAAAAAAAGGGGGTCTGG + Intergenic
1009204585 6:60786487-60786509 AGAAACAAAAAAAGGGGGTCTGG + Intergenic
1010437161 6:75845687-75845709 CAAACAAAAAAAAGCTGGTCAGG + Intronic
1010541707 6:77099683-77099705 TAAAACAAAACAAGGTGGTGGGG - Intergenic
1010982307 6:82382100-82382122 CAAAAAAAAAAGAGGGGGGAGGG - Intergenic
1011254299 6:85405305-85405327 CAAAATAAACAGAGCTGATCTGG + Intergenic
1011918716 6:92544194-92544216 AAAAAAAAAAAGAAGTGATCAGG - Intergenic
1012802450 6:103848610-103848632 CAAAACAGAAAGAGATGTTTGGG + Intergenic
1012956972 6:105581676-105581698 GAAAACAAAAAGAGGTCTGCAGG - Intergenic
1013211898 6:107994466-107994488 AAAAACAAAAAGTAGTGGTGGGG - Intergenic
1013345785 6:109259399-109259421 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
1013438348 6:110136636-110136658 CACAACCAAAAGAGCTGGTACGG - Intronic
1013486323 6:110599665-110599687 AAAAAAAAAAAGAGGTGATTAGG + Intergenic
1013528128 6:110994282-110994304 AAAAAAAAAAAGAGTTGGTTAGG + Intronic
1013546385 6:111161702-111161724 CAAAACAAAATAAGGGGGTAAGG + Intronic
1013556023 6:111258269-111258291 CAAAAAAAAAAGTGGGGGTGCGG + Intergenic
1013603783 6:111729475-111729497 AAAAAAAAAAAAAGGGGGTCGGG + Intronic
1013723805 6:113066665-113066687 AAAGTCCAAAAGAGGTGGTCGGG - Intergenic
1013835694 6:114332779-114332801 GAAAACAAAGAGAGGTAGTGTGG + Intronic
1013982459 6:116147984-116148006 CAAAAAAAAAAAAGGTGGGGGGG + Intronic
1014465764 6:121755097-121755119 CAAACCAAAAAGAGATAGGCCGG + Intergenic
1014767116 6:125419457-125419479 AAAAAATAAAAGAGGTGGTAAGG + Intergenic
1015174555 6:130292586-130292608 CAAACAAAAAAGAGTTGTTCCGG - Intronic
1015304896 6:131696760-131696782 AAAAAAAAAAAAAGGTGCTCTGG - Intronic
1015589361 6:134807947-134807969 AAAAAAAAAAAAAGGTGGTATGG - Intergenic
1016007097 6:139100344-139100366 TAAAACAAAACTAGGAGGTCAGG - Intergenic
1016041184 6:139433211-139433233 AAAAAAAAAAAAAGGTGGCCAGG - Intergenic
1016460174 6:144273637-144273659 AAAAAAAAAAAGTGGGGGTCGGG + Intergenic
1016831789 6:148441474-148441496 CAAAACAAAAAAAGCTGATGGGG - Intronic
1017110229 6:150925175-150925197 CACAACAAAAATAAGTGTTCTGG + Intronic
1017338194 6:153286957-153286979 CAAACCAAAAACAGGAGGTGGGG - Intergenic
1017428865 6:154350879-154350901 AAAAACAAAAAAATGTGGCCAGG - Intronic
1017603096 6:156104789-156104811 CAGAACAAAAATCTGTGGTCTGG - Intergenic
1018323361 6:162636959-162636981 AAAAAAAAAAAGATGTGGCCAGG + Intronic
1019986354 7:4659135-4659157 AAAAACAAAAAGAGCTGGCTGGG + Intergenic
1020062529 7:5163009-5163031 CAAAAAAAAAAGTGGTGGAATGG + Intergenic
1020113399 7:5460899-5460921 CAAAACAAAAAAATATGGTGAGG - Intronic
1020664349 7:11020672-11020694 AAAAAAAGAAAGAAGTGGTCAGG - Intronic
1021480302 7:21107916-21107938 TAAAAAAAAAAAAGGTGGACAGG - Intergenic
1021730564 7:23591511-23591533 AAAAAGAAAAAGAGCTGGCCGGG - Intergenic
1021883877 7:25119570-25119592 TAAAAAAAAAAAAAGTGGTCTGG - Intergenic
1021987782 7:26113930-26113952 CAAAAAAAAAAGGGGGGGTCTGG + Intergenic
1022070790 7:26911913-26911935 AAAAAAAAAAAGAGGTTATCAGG - Intronic
1022454531 7:30546777-30546799 CAAAAAAATCAGAGGTGGTCTGG + Intronic
1022689328 7:32631582-32631604 AAAAATCAAATGAGGTGGTCAGG - Intergenic
1022774530 7:33511948-33511970 GCAAACAAAAAGAGGAAGTCTGG + Intronic
1022916908 7:34965937-34965959 AAAAATCAAATGAGGTGGTCAGG - Intronic
1023104754 7:36752665-36752687 AAAAAAAAAAAGAGGTGATTAGG - Intergenic
1024313394 7:47991092-47991114 CAAACCAAAAAAACGGGGTCTGG + Intronic
1024769166 7:52698083-52698105 TAAAATAAAAAGAGGAAGTCAGG - Intergenic
1025152747 7:56573027-56573049 AAAAAAAAAAAGAGCTGGTGTGG - Intergenic
1025169156 7:56740718-56740740 AAAAAAAAAAAGTGGTGGTAGGG - Intergenic
1025950343 7:66140315-66140337 GCAAACAAAAGCAGGTGGTCTGG - Intronic
1026931939 7:74227878-74227900 AAAAACAAAAAGAAGAGGCCAGG + Intronic
1027047015 7:74997720-74997742 AAAAACAAAAACACCTGGTCAGG - Intronic
1027180220 7:75934329-75934351 CAACAAAAAAAGAGGTGACCTGG + Intronic
1027222240 7:76221348-76221370 AAAAAAAAAAAGAGGAGGGCAGG - Intronic
1027255514 7:76428320-76428342 CAAAAAAACAAAAGGTGGTTAGG + Intronic
1027415999 7:77975491-77975513 AAAAAAAAAAAGACGTGGTTTGG + Intergenic
1027698763 7:81442762-81442784 AAAAAAAAAAAGAAGTGCTCTGG - Intergenic
1027845132 7:83363133-83363155 CAAAAAAAACAGTGGTAGTCTGG + Intergenic
1028250762 7:88537833-88537855 CAAAACAAAACAAGGTATTCAGG - Intergenic
1029356487 7:100055936-100055958 AAAAAAAAAAAGAGGAGGGCCGG - Intronic
1030415836 7:109241375-109241397 AAAAAAAAAAAGAGCTGGCCGGG - Intergenic
1030799389 7:113830206-113830228 CAAAACAAAAAAACATGGTGGGG + Intergenic
1031048546 7:116921384-116921406 AAAAAAAAAAAGTGGTGGGCTGG + Exonic
1031441148 7:121796001-121796023 AAAAACAGAAAGAGTTGCTCAGG + Intergenic
1031944519 7:127825402-127825424 AAAAAAAAAAAAAGGTGGCCAGG - Intronic
1032100947 7:128977081-128977103 AAAAACAAAAATAGGTGGCAAGG + Intronic
1032278281 7:130479497-130479519 CAAAACAAAAAAAAGTAGCCAGG - Intergenic
1032330207 7:130971629-130971651 AAAAAAAAAAAAAGGTGGTGGGG + Intergenic
1033198049 7:139343936-139343958 AAAAAAAAAAAGAGTTGGTGGGG + Intronic
1033373685 7:140736421-140736443 AAAAAAAAAAAGTGGTGTTCAGG - Intronic
1033816496 7:145080705-145080727 CAAAACAAAACAAGGTATTCAGG - Intergenic
1034316691 7:150139569-150139591 CAGAATAAAAAGAGATGATCCGG - Intergenic
1034410036 7:150935903-150935925 AAATACAAAAAGATGTGGCCGGG + Intergenic
1034790174 7:153961113-153961135 CAGAATAAAAAGAGATGATCTGG + Intronic
1034879948 7:154755898-154755920 CATAATAAAAAGACGTGGTGAGG - Intronic
1035174092 7:157038205-157038227 TAAAATAAAAAGATGTGGCCAGG + Intergenic
1035309917 7:157960709-157960731 AAAAACAAAAAAACATGGTCAGG + Intronic
1036655942 8:10677568-10677590 AAATAAAAAAAGAGGTGGTGTGG - Intronic
1037107955 8:15132843-15132865 CAAAAATAAAAGAAGTGGCCAGG + Intronic
1038391986 8:27210360-27210382 CCAAAGAAGAAGAGGTGGGCAGG + Intergenic
1038727035 8:30090803-30090825 CAAAACAAGAAAAGGTGTTGTGG + Intergenic
1039343511 8:36677242-36677264 TAAAAAAAAAAGAGGTGGGGGGG - Intergenic
1039555531 8:38472335-38472357 CCAAACAAAGAGAGCTGGCCGGG - Intergenic
1039604510 8:38869400-38869422 CAAAACAAAAATAGGATGTTGGG - Intergenic
1039826798 8:41181611-41181633 CAAAAAATAAAGTGGTGGGCCGG + Intergenic
1040477716 8:47795179-47795201 AAAAAAAAAAAGAGTTGGCCAGG - Intronic
1041189448 8:55338616-55338638 CAACTCAACAAGATGTGGTCAGG + Intronic
1041548656 8:59076007-59076029 AAAAAAAAAAAAAGGGGGTCAGG + Intronic
1042507124 8:69572816-69572838 CAAAACAAAAAGTGGGAATCTGG - Intronic
1042908895 8:73804059-73804081 GAAAACACAAAGAAGTGGCCGGG - Intronic
1043242794 8:77957270-77957292 CAAAACAAAAAAAATTGGCCCGG + Intergenic
1043311938 8:78871581-78871603 CAAAACAAAAAAAGTTGGCCAGG - Intergenic
1043754082 8:83980230-83980252 TAAGACAAAAAGAGGAGCTCAGG + Intergenic
1044246703 8:89956205-89956227 AAAAACAAAAACAAGAGGTCAGG + Intronic
1044682961 8:94800395-94800417 AAAAAAAAAAACAGGTGGTGGGG + Intergenic
1044789938 8:95837010-95837032 CAAAGAAAAAAAATGTGGTCTGG + Intergenic
1044986462 8:97760468-97760490 CAAAACAAAAAAAACAGGTCAGG + Intergenic
1045553984 8:103197334-103197356 TAAAAAAAAAAGAGGTGGCAGGG + Intronic
1045842938 8:106600603-106600625 CAAAACAAAAAGAGGTCCATTGG - Intronic
1047965087 8:130040528-130040550 AAAAAAAAAAAAAAGTGGTCTGG + Intergenic
1048389780 8:133951674-133951696 GAAAGAAAAAAGAGGTGGTCAGG - Intergenic
1048766934 8:137854826-137854848 CAAAACAAAAAGAAGAGATAGGG - Intergenic
1048835153 8:138512338-138512360 TAAAGTAAAAAGAGGTGGTGTGG + Intergenic
1049395827 8:142400042-142400064 AAAAAAAAAAAGAGGTGGCTGGG + Intronic
1050928573 9:11297090-11297112 CAAAAAAAAAAAAGGTGGCTGGG + Intergenic
1051412506 9:16805061-16805083 CAAAAGAAAAAAAAGTGGTGTGG + Intronic
1052051396 9:23852439-23852461 AAAAAAAAAAAAAGGTGGTGGGG - Intergenic
1052846087 9:33337751-33337773 CAAAACAAAAACTGATGGCCGGG + Intronic
1052856918 9:33413033-33413055 AAAAACAAAAAAAAGTGGCCAGG + Intergenic
1053044297 9:34901601-34901623 GAAAATAAAAATAGGGGGTCGGG + Intergenic
1053340341 9:37321281-37321303 AAAAAGAAAAAAAGGTGGCCGGG - Intronic
1055316153 9:75036414-75036436 AAAAAAAAAAAAAGGTGGGCTGG + Intergenic
1055674352 9:78640131-78640153 AAAAAAAAAAAAAGGTGGCCAGG + Intergenic
1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG + Intergenic
1056434715 9:86564711-86564733 CAAAAAAAAGAGAGTTGGTAAGG - Intergenic
1056549330 9:87638657-87638679 CAAGGCAGGAAGAGGTGGTCTGG + Intronic
1056584402 9:87919063-87919085 AAAAACAGGAAGAGGGGGTCGGG - Intergenic
1056612465 9:88133844-88133866 AAAAACAGGAAGAGGGGGTCGGG + Intergenic
1056637087 9:88340095-88340117 CAAAAAAAAAAAAAGTGGCCTGG + Intergenic
1056984297 9:91347025-91347047 CAAAACAAAAAATGGGGCTCAGG - Intronic
1057466982 9:95323275-95323297 CAAAAAAAAAAAAGGAGGGCTGG + Intergenic
1058825070 9:108768232-108768254 CAAAACACAAAGATGTCATCTGG + Intergenic
1058828151 9:108793367-108793389 CAAAAGAAAGAGAGGTGGTAGGG - Intergenic
1059225866 9:112672396-112672418 CAAAAAAAAAAGAGGGAGTCCGG + Intergenic
1059688284 9:116658720-116658742 AAAAAAAAAGAGCGGTGGTCAGG - Intronic
1059817362 9:117932325-117932347 AAAAACAAAAAGATTTGGGCTGG - Intergenic
1060861622 9:126959582-126959604 AAAAAAAAAAAGAACTGGTCAGG - Intronic
1061072492 9:128319912-128319934 CAAAAAAAAAAAAAGTGGCCAGG - Intronic
1061105997 9:128530910-128530932 AAAAAAAAAAAAAGGTGGGCCGG + Intronic
1061441520 9:130607270-130607292 AAAAAAAAAAAAAGGAGGTCAGG - Intronic
1061479439 9:130889662-130889684 AAAAAAAAAAAGTGGTGGGCCGG - Intergenic
1061852241 9:133423075-133423097 CAAGACAAAAAGAGATGGATGGG - Intronic
1061944878 9:133903086-133903108 AAAAAAAAAAAGAGGTAGTTTGG + Intronic
1062376652 9:136264752-136264774 CAAAAAAAAAAAAGGTGAGCTGG - Intergenic
1062416337 9:136452468-136452490 AAAAAAAAAAAGAGATGGCCAGG + Intronic
1062551292 9:137087850-137087872 CAAAATAAATAGAGCTGGCCGGG + Intronic
1062617900 9:137406469-137406491 CAAGACAAACAGAGGTGGAGCGG - Intronic
1185596724 X:1311592-1311614 CAAAACAAAAAAAAGTAGCCGGG - Intergenic
1185609021 X:1383316-1383338 AAAAACAAACAGGGGTGGTGGGG - Intergenic
1185636548 X:1556229-1556251 CAAAAGAAAAAAAAATGGTCGGG + Intergenic
1186068353 X:5790577-5790599 AAAAAAAAAAAGTGATGGTCTGG + Intergenic
1186153318 X:6699700-6699722 AAAAAAAAAAAGAGGTGGGGAGG - Intergenic
1187037714 X:15559565-15559587 CCAGACAAAAACAGGTGGTGGGG + Intergenic
1187062383 X:15799444-15799466 AAAAAAAAAAAAAGGTGGTGGGG - Intronic
1187077809 X:15952921-15952943 AAAAAAAAAAAGAGGAGGCCGGG - Intergenic
1187123114 X:16428342-16428364 AAAAAAAAAAAAAGGTAGTCAGG + Intergenic
1187553276 X:20327020-20327042 CCAAACTAAAAGAGTAGGTCTGG + Intergenic
1188016114 X:25110262-25110284 CAAAAAACAAAGAGGTGGGCCGG - Intergenic
1188896830 X:35679152-35679174 CAAAACAAAAAGCGGGGGATGGG + Intergenic
1189019181 X:37316862-37316884 CAAAATAAAAAGTGCTGGTCAGG - Intergenic
1189152199 X:38720169-38720191 AAAAAAAAAAAGAGATGGCCAGG + Intergenic
1189328319 X:40126848-40126870 AAAAAAAAAAAGAGGAGGTTAGG + Intronic
1189860487 X:45266124-45266146 TAAAAGGAATAGAGGTGGTCTGG - Intergenic
1190199244 X:48345872-48345894 CAAAATAAAAACTGGGGGTCAGG + Intergenic
1190343711 X:49318461-49318483 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190344807 X:49327989-49328011 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190345900 X:49337546-49337568 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190347003 X:49347096-49347118 GAAAACAAAAAAATGTAGTCAGG - Intergenic
1190347155 X:49528568-49528590 GAAAACAAAAAAATGTAGTCAGG - Intergenic
1190348254 X:49538123-49538145 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190349355 X:49547679-49547701 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190350459 X:49557235-49557257 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190351561 X:49566790-49566812 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190352661 X:49576347-49576369 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190353762 X:49585895-49585917 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190354864 X:49595417-49595439 GAAAACAAAAAAATGTAGTCAGG - Intronic
1190767379 X:53486812-53486834 AAAAACAAAAAAAGTTAGTCAGG - Intergenic
1190835355 X:54095641-54095663 CCAAAAAAAAAGATGTGGGCTGG - Intronic
1190836273 X:54103744-54103766 AAAAAAAAAAAGAGGTGTTTTGG - Intronic
1191845164 X:65541810-65541832 CCAAACACAAAAAGGTAGTCTGG - Intergenic
1193168409 X:78307910-78307932 CCAAACAAAAAGAGTTTATCAGG + Intronic
1193818664 X:86134872-86134894 CAAAGAAAAAAGAAGTGATCAGG + Intergenic
1194223137 X:91222241-91222263 AAAAACAAAAACAGGATGTCAGG + Intergenic
1194419528 X:93656346-93656368 CAAAACTAAAAGAGGTTTTGAGG + Intergenic
1195034850 X:100963197-100963219 CAAAAGAAAAATAGCTGGGCTGG + Intergenic
1195276774 X:103288684-103288706 CAAAAAAAAAAAAGTTGGACGGG + Intergenic
1195596048 X:106691087-106691109 CAAAAAAAAAATAGCTGGTGTGG - Intergenic
1196784403 X:119409504-119409526 AAAAAAAAAAAAAGGTGGGCTGG - Intronic
1197290421 X:124649904-124649926 AAAAATAAAATGAGGAGGTCAGG + Intronic
1198176827 X:134164647-134164669 CAAAAAAAAAAGAGGGTGCCTGG + Intergenic
1198431418 X:136570538-136570560 CAAAACAAAAAATGGGGGTAGGG - Intergenic
1199228406 X:145407053-145407075 TAAAAAAAAAAGAGGAGGCCGGG + Intergenic
1199587040 X:149425523-149425545 CAAAACAAAACAAGGTATTCAGG + Intergenic
1199893235 X:152109131-152109153 CAAAACAAAAGGAAGTGGCTAGG - Intergenic
1201291518 Y:12425081-12425103 CAAAATCAAAAGATGTGGTGAGG - Intergenic
1201692179 Y:16779296-16779318 CAAAAAAAAAAAAAGAGGTCGGG - Intergenic
1202274970 Y:23108162-23108184 CAAAACCTAAACAGGTGGTATGG + Intergenic
1202291058 Y:23312527-23312549 CAAAACCTAAACAGGTGGTATGG - Intergenic
1202427961 Y:24741884-24741906 CAAAACCTAAACAGGTGGTATGG + Intergenic
1202442830 Y:24928207-24928229 CAAAACCTAAACAGGTGGTATGG - Intergenic