ID: 1104392772

View in Genome Browser
Species Human (GRCh38)
Location 12:128405026-128405048
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104392772_1104392779 4 Left 1104392772 12:128405026-128405048 CCAGGCTGTCTCCCGTGGCCGTA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1104392779 12:128405053-128405075 ACCAGCATTGGACTTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 127
1104392772_1104392782 17 Left 1104392772 12:128405026-128405048 CCAGGCTGTCTCCCGTGGCCGTA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
1104392772_1104392776 -8 Left 1104392772 12:128405026-128405048 CCAGGCTGTCTCCCGTGGCCGTA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1104392776 12:128405041-128405063 TGGCCGTAGGAAACCAGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 119
1104392772_1104392781 5 Left 1104392772 12:128405026-128405048 CCAGGCTGTCTCCCGTGGCCGTA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1104392781 12:128405054-128405076 CCAGCATTGGACTTTTCCAGGGG 0: 1
1: 0
2: 2
3: 8
4: 150
1104392772_1104392778 3 Left 1104392772 12:128405026-128405048 CCAGGCTGTCTCCCGTGGCCGTA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1104392778 12:128405052-128405074 AACCAGCATTGGACTTTTCCAGG 0: 1
1: 0
2: 1
3: 36
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104392772 Original CRISPR TACGGCCACGGGAGACAGCC TGG (reversed) Intronic