ID: 1104392775

View in Genome Browser
Species Human (GRCh38)
Location 12:128405038-128405060
Sequence ATGCTGGTTTCCTACGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104392775_1104392779 -8 Left 1104392775 12:128405038-128405060 CCGTGGCCGTAGGAAACCAGCAT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1104392779 12:128405053-128405075 ACCAGCATTGGACTTTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 127
1104392775_1104392778 -9 Left 1104392775 12:128405038-128405060 CCGTGGCCGTAGGAAACCAGCAT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1104392778 12:128405052-128405074 AACCAGCATTGGACTTTTCCAGG 0: 1
1: 0
2: 1
3: 36
4: 123
1104392775_1104392782 5 Left 1104392775 12:128405038-128405060 CCGTGGCCGTAGGAAACCAGCAT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
1104392775_1104392781 -7 Left 1104392775 12:128405038-128405060 CCGTGGCCGTAGGAAACCAGCAT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1104392781 12:128405054-128405076 CCAGCATTGGACTTTTCCAGGGG 0: 1
1: 0
2: 2
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104392775 Original CRISPR ATGCTGGTTTCCTACGGCCA CGG (reversed) Intronic