ID: 1104392777

View in Genome Browser
Species Human (GRCh38)
Location 12:128405044-128405066
Sequence AGTCCAATGCTGGTTTCCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104392777_1104392782 -1 Left 1104392777 12:128405044-128405066 CCGTAGGAAACCAGCATTGGACT 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104392777 Original CRISPR AGTCCAATGCTGGTTTCCTA CGG (reversed) Intronic