ID: 1104392782

View in Genome Browser
Species Human (GRCh38)
Location 12:128405066-128405088
Sequence TTTTCCAGGGGTATTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104392774_1104392782 6 Left 1104392774 12:128405037-128405059 CCCGTGGCCGTAGGAAACCAGCA 0: 1
1: 0
2: 1
3: 7
4: 78
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
1104392770_1104392782 25 Left 1104392770 12:128405018-128405040 CCTGCTCTCCAGGCTGTCTCCCG 0: 1
1: 1
2: 0
3: 28
4: 278
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
1104392777_1104392782 -1 Left 1104392777 12:128405044-128405066 CCGTAGGAAACCAGCATTGGACT 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
1104392772_1104392782 17 Left 1104392772 12:128405026-128405048 CCAGGCTGTCTCCCGTGGCCGTA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
1104392775_1104392782 5 Left 1104392775 12:128405038-128405060 CCGTGGCCGTAGGAAACCAGCAT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1104392782 12:128405066-128405088 TTTTCCAGGGGTATTGTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104392782 Original CRISPR TTTTCCAGGGGTATTGTTTC AGG Intronic