ID: 1104393409

View in Genome Browser
Species Human (GRCh38)
Location 12:128410297-128410319
Sequence CTCAAACAGCTTGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104393409 Original CRISPR CTCAAACAGCTTGGGGTGGA GGG (reversed) Intronic
900912181 1:5606306-5606328 CTCAAACAACATGGGTTTGAGGG - Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
907336912 1:53705751-53705773 TGGAAACAGCTTGGGATGGAAGG - Intronic
907473442 1:54689605-54689627 TGCAAACAGCTTGGGTTTGAAGG + Intronic
912267102 1:108168945-108168967 CTATAACAGCTTGAGGTGGTGGG - Intronic
912601461 1:110938526-110938548 CTCAAAGAACTTGGGATAGAAGG + Intergenic
915043159 1:152985349-152985371 CTCAGGCACCTTGGGGTGGCAGG - Exonic
915047700 1:153032464-153032486 CTCAGGCACCTTGGGGTGGCAGG - Exonic
919973045 1:202593073-202593095 CCCAAACAGCTTTAGGTGGGAGG + Exonic
920741865 1:208588449-208588471 CTAAAAGAGTTTGGGGTGTATGG - Intergenic
921416248 1:214890743-214890765 CACAAACAGAGTGGGGAGGAGGG + Intergenic
921951988 1:220939698-220939720 ATCAAACAGCTTTGTGTGAAAGG - Intergenic
1064910000 10:20390426-20390448 CTCAAACAGCGTGGAGGGAAAGG + Intergenic
1070916181 10:80156419-80156441 CTCAAGTTGCTTAGGGTGGAAGG - Intronic
1073178146 10:101569074-101569096 CTCAGGTAGCTTGGGGTGGGAGG + Intergenic
1073730850 10:106285861-106285883 CTCAACCAGCTTAGGGTTCATGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077527346 11:3075144-3075166 CACAAACAGCTTAGGCAGGAAGG - Intergenic
1082132114 11:48503604-48503626 CTGAAAAAGCTGGGGGTAGAAGG + Intergenic
1082788885 11:57333532-57333554 CTCAAACTCCTGTGGGTGGAGGG + Exonic
1083257611 11:61506211-61506233 CTCAAACTGCTTGGGGGTGGGGG + Intergenic
1083769754 11:64860023-64860045 CTCAAAGAGCTTGCGGTTGTCGG + Exonic
1086379014 11:86232270-86232292 TCCAAACACCCTGGGGTGGAGGG - Intergenic
1086421778 11:86644543-86644565 CACAAATAGCTTGGCATGGAAGG - Intronic
1087445563 11:98247450-98247472 CTCAAAAAACTTGGTGTAGAAGG - Intergenic
1088022111 11:105132245-105132267 CTATTTCAGCTTGGGGTGGAAGG + Intergenic
1088345030 11:108814108-108814130 CTAATAAAGCTTTGGGTGGAAGG - Intronic
1088996920 11:115008820-115008842 CCCAAAAGGCTGGGGGTGGACGG + Intergenic
1089963247 11:122634696-122634718 CTCACACAGCTGGTGGTGGCTGG + Intergenic
1091007057 11:131962819-131962841 CTCACACTACTTGGGGTGGAAGG - Intronic
1097249134 12:57622798-57622820 CTCAGCCAGGTTGGGGAGGAGGG - Exonic
1101434325 12:104652133-104652155 CTCTAAGAGCTGGGGGTGGGTGG - Intronic
1102801009 12:115733905-115733927 GTAAAACAGCTCGGGGTTGAGGG - Intergenic
1104044814 12:125154255-125154277 CTCACCCAGGCTGGGGTGGAGGG + Intergenic
1104245618 12:127038317-127038339 CAGACACAGCTTGGGGAGGAGGG - Intergenic
1104393409 12:128410297-128410319 CTCAAACAGCTTGGGGTGGAGGG - Intronic
1104457232 12:128924953-128924975 CTAAGACTGCTTGTGGTGGATGG - Intronic
1104970360 12:132528133-132528155 CTCAAACACCATGGGGTTGGTGG + Intronic
1107843180 13:44481268-44481290 CAGAAAAAGCTTGGGGTGGGAGG + Intronic
1112553060 13:100440673-100440695 TTCAAACAGATGGGGGTGGGGGG - Intronic
1113256182 13:108508684-108508706 CTCTGCCAGCTTGGGGTAGAGGG + Intergenic
1114536756 14:23427811-23427833 GTCAAACAGCTTGGCCTTGAAGG + Exonic
1114926545 14:27407768-27407790 CTAAAATAACTTGGGGTGAAGGG + Intergenic
1117261313 14:54036514-54036536 TTTAAACAGCATGGGGTTGAGGG + Intergenic
1117469829 14:56031923-56031945 CTCAAACAGCTTTCTGAGGACGG - Intergenic
1117869911 14:60189473-60189495 CACAAAGAGGTTGAGGTGGAGGG - Intergenic
1117959544 14:61149154-61149176 CTGAACCTGTTTGGGGTGGAGGG - Intergenic
1118763038 14:68892275-68892297 CTCCAACAGCTAGGGTGGGAAGG + Exonic
1121378321 14:93434501-93434523 CAGAAAAAGTTTGGGGTGGAGGG - Intronic
1121695115 14:95906033-95906055 CAAAAACAGGTGGGGGTGGAGGG - Intergenic
1122097635 14:99383161-99383183 CTTAAAGGGCATGGGGTGGAAGG + Intergenic
1122555942 14:102580148-102580170 CACAAGCAGCTTGAGCTGGAAGG + Intergenic
1123982640 15:25617889-25617911 CTCAAACATCTGGGGCTTGAGGG - Intergenic
1128730706 15:70019007-70019029 CTCCAACATCTTGGGGCTGAAGG + Intergenic
1128930832 15:71703683-71703705 CTACCACAGCCTGGGGTGGATGG + Intronic
1130109549 15:80953404-80953426 CACAGAGAGGTTGGGGTGGAGGG + Intronic
1131518129 15:93092967-93092989 CTCAAACAGCTGGGAGAGGAGGG + Intergenic
1131816235 15:96223949-96223971 TTCAAAGACCCTGGGGTGGAAGG + Intergenic
1132739831 16:1406158-1406180 CTGAAACAGCTGGGGGTGATGGG + Intronic
1136458662 16:30396476-30396498 CTCAAGAAGCTTAGGGTGGTAGG - Intronic
1138196160 16:55053841-55053863 CTAAGACATCTTGGGATGGAGGG + Intergenic
1139449112 16:67016191-67016213 CTGAGACACCTTGGGGTGGGAGG + Intergenic
1202994308 16_KI270728v1_random:93059-93081 CTCAAACAGGTTGGTTTGGCTGG + Intergenic
1203020995 16_KI270728v1_random:405401-405423 CTCAAACAGGTTGGTTTGGCTGG + Intergenic
1203039330 16_KI270728v1_random:678559-678581 CTCAAACAGGTTGGTTTGGCTGG + Intergenic
1143070486 17:4288041-4288063 CTGAAACATTTTGGGGTGAAGGG + Intronic
1144509352 17:15861977-15861999 CTAAAACAGGTTCAGGTGGAGGG - Intergenic
1145173464 17:20679624-20679646 CTAAAACAGGTTCAGGTGGAGGG - Intergenic
1148121640 17:45216116-45216138 CTCAGGCAGCTTGGGGATGATGG + Intergenic
1150444066 17:65214878-65214900 CTAAATCAGCCAGGGGTGGATGG - Intronic
1152699355 17:81811427-81811449 CGCAAACAGATTCGCGTGGATGG - Exonic
1152921762 17:83069393-83069415 CTCCGACAGCATGGGGTGGTGGG - Intergenic
1154412951 18:14151132-14151154 CTGAAACAACTGGGGGTGGCAGG + Intergenic
1155781697 18:29845458-29845480 CTCAAAAAACTTGGGATAGAAGG - Intergenic
1162328019 19:10010224-10010246 CTAAAAGAGCGAGGGGTGGAGGG - Intronic
1163517674 19:17774836-17774858 CTCAAACAGCCTGGGAGGGAAGG - Intronic
1163849459 19:19655027-19655049 CTGCAAGGGCTTGGGGTGGATGG + Intronic
1165767264 19:38359310-38359332 CTCAAAGGGTTTGGGGTGGGGGG + Intronic
1166262014 19:41646755-41646777 CACAAACCGCGTGGGGTGGGTGG - Intronic
1167036881 19:47000074-47000096 CGCAAACCCCTGGGGGTGGATGG - Intronic
1167173727 19:47851038-47851060 CTCATACAGCTTGGTGTTGCTGG - Intergenic
1167444158 19:49527740-49527762 CTAGAACAGCTGGAGGTGGACGG + Exonic
1167697960 19:51026038-51026060 CCCCAGCAGCTTGGGGTGGAAGG + Intronic
1168064325 19:53910351-53910373 CTCCAAGAGGTTGGGGGGGAAGG + Intronic
925061385 2:893518-893540 CTCCAGCAGCCTGGGGTGGGAGG - Intergenic
926784245 2:16504953-16504975 CTCAGACAGCTTTGGGCGCAGGG + Intergenic
930057384 2:47262531-47262553 CTCAAACAGCTTGGTGGAGGTGG + Intergenic
930662478 2:54068799-54068821 CTCAAACAGCCTGTGTTTGAAGG + Intronic
932338222 2:70943210-70943232 CTCAATCAGTGTGGGGTGAATGG + Intronic
933813045 2:86044915-86044937 TCCCCACAGCTTGGGGTGGAGGG - Intronic
935128985 2:100247375-100247397 CTCAGGCAGCTTGAGGAGGATGG - Intergenic
936160876 2:110083385-110083407 CTGCAACAGCTGTGGGTGGATGG + Intergenic
936183787 2:110287969-110287991 CTGCAACAGCTGTGGGTGGATGG - Intergenic
938505158 2:131872301-131872323 CTCAAACATAATGGAGTGGAAGG - Intergenic
946161433 2:217838343-217838365 CTGCAGCAGCTTGGGGTGCAGGG + Intronic
946402525 2:219476012-219476034 CTCAAACACGCTGGGGTGGGGGG + Intronic
948254286 2:236554656-236554678 CGCAAACAGCAGGGGGTGCAGGG + Intergenic
948999713 2:241606280-241606302 GTCAAGCAGGGTGGGGTGGAGGG + Intronic
1168848782 20:962475-962497 CTCCAAGAGCTGGGGGTGAATGG - Intronic
1169491573 20:6075788-6075810 CACAAAGAACTTGGGGTGTAAGG - Exonic
1170677456 20:18495689-18495711 GGCAAGCAGCTTGGGGAGGAGGG - Intronic
1172852655 20:37977721-37977743 GTCAAACAGTTCGGGGTTGATGG + Intergenic
1174920910 20:54701061-54701083 CTGACACAGCTTGTGGTTGATGG - Intergenic
1175651926 20:60732470-60732492 CTCAAACAGATTCGATTGGAGGG + Intergenic
1176672141 21:9744862-9744884 CACAAACAGCTGGGGGGGGGAGG + Intergenic
1176860059 21:14007120-14007142 CTGAAACAACTGGGGGTGGCAGG - Intergenic
1177987072 21:27989768-27989790 CTCAAAGATAATGGGGTGGAAGG + Intergenic
1180560815 22:16612926-16612948 GACAAGCAGCTTGGGGAGGAGGG - Intergenic
1182888766 22:33798692-33798714 GTCAAGGAGCTTGGGGTGCAGGG - Intronic
1183180758 22:36258146-36258168 CTAACACAGCTGGGGGGGGACGG - Intronic
1183228706 22:36567571-36567593 CTCCTACAGTTGGGGGTGGATGG + Intronic
1185411929 22:50687234-50687256 CTGACACAGCCTGGGGTGGAGGG - Intergenic
949568776 3:5271035-5271057 CTCACATAGCTGTGGGTGGATGG + Intergenic
949905530 3:8855496-8855518 CTCAGAGAGCTAGGGGTGGCAGG - Intronic
950609970 3:14120216-14120238 ACTAAACAGCTGGGGGTGGAAGG - Intronic
951552840 3:23892752-23892774 CCGAAACAGCTTGGGGTTGGGGG + Exonic
956019061 3:64914212-64914234 TACAAACAGCTGGGGGTAGAAGG - Intergenic
958472730 3:94541865-94541887 CTCCTTCAGCCTGGGGTGGATGG - Intergenic
961724252 3:128915575-128915597 GGCAGACAGGTTGGGGTGGAAGG + Intronic
961944346 3:130670662-130670684 CACTGCCAGCTTGGGGTGGATGG - Intronic
962344456 3:134609215-134609237 CAGAAACAGGTTGGGGTAGATGG - Intronic
962436761 3:135374038-135374060 TTCAATCAGCTTGGTGAGGAAGG - Intergenic
969299063 4:6286821-6286843 CTCAAAGCGCTCGGGGTGGGAGG - Intronic
972041344 4:34604028-34604050 CTCTAACAGCTGTGGTTGGATGG + Intergenic
972885053 4:43475734-43475756 CACATAAAGCTGGGGGTGGAGGG + Intergenic
981584116 4:146282472-146282494 CACAAACTCCTTGGGGTGGTGGG - Intronic
981818692 4:148861118-148861140 CTAAAACAGCTTAGGGAGAAAGG + Intergenic
983808197 4:172021116-172021138 CTCAAACAGCTGGGTGTAGAAGG + Intronic
985402595 4:189606986-189607008 CACAAACAGCTGGGGGGGGGAGG - Intergenic
985537177 5:472178-472200 CTCCCAGAGCTTGGGCTGGATGG + Intronic
985835522 5:2269360-2269382 CCCACACAGCTGGTGGTGGATGG + Intergenic
985941880 5:3142703-3142725 CTGAAAATCCTTGGGGTGGACGG + Intergenic
985974930 5:3410560-3410582 TTAAAAGAGCTTGGGGTGGGAGG - Intergenic
987611260 5:20206817-20206839 CTCAAAAAACTTGGTGTAGAAGG + Intronic
988452567 5:31357838-31357860 GTTAAAGATCTTGGGGTGGAGGG - Intergenic
997606740 5:135180280-135180302 CTCACCCACCTTGGTGTGGAGGG - Intronic
999937947 5:156508331-156508353 CACACACAGATTGGGGTGGGGGG - Intronic
1002372562 5:178767026-178767048 CTCACCCAGGCTGGGGTGGAGGG - Intergenic
1003058131 6:2841465-2841487 CACAAACAGCTCTGGGAGGAAGG + Intronic
1007095198 6:39208635-39208657 CACAGACATCTTGGGATGGATGG + Intronic
1007495856 6:42259947-42259969 CTGAAAGAGCTGGGGGTGGTAGG + Intronic
1009535290 6:64874772-64874794 TTCAAACAACTAGGGATGGAAGG - Intronic
1010437756 6:75854640-75854662 CTCATATTGCTTGGGGTCGAAGG - Intronic
1010677872 6:78765569-78765591 CTCAAACAACTTGGTATAGAAGG + Intergenic
1011591468 6:88974364-88974386 CTTAAACAACTTGGTGTGGGAGG - Intergenic
1013866640 6:114706107-114706129 GTTAAACATCTTGGGGTGAAGGG + Intergenic
1017408741 6:154147473-154147495 CTCAAACAGCTCAGGGATGAAGG - Intronic
1019622305 7:1998589-1998611 CTGGAACAGCCTGGGGTGGGTGG - Intronic
1020846635 7:13293533-13293555 GTCAAACAGCAGGGGGTGGGGGG - Intergenic
1021718186 7:23480595-23480617 GAAAAACAGCTTGGGGGGGAGGG - Intergenic
1021892947 7:25204857-25204879 TTCAGACCTCTTGGGGTGGAGGG - Intergenic
1022863646 7:34394532-34394554 CTCAAACAGTTTTGGCTTGAAGG + Intergenic
1023165067 7:37335688-37335710 CTCAAATGGCTTGGGGCAGAGGG - Intronic
1026471922 7:70701057-70701079 CTTAAACATCTGGAGGTGGAGGG - Intronic
1026802416 7:73408671-73408693 GTCAAAAAGGTTGGGGTGGCTGG + Intergenic
1026869202 7:73840509-73840531 CTCCAGCTGCATGGGGTGGATGG - Exonic
1028202289 7:87975933-87975955 CTCAAAGAGCTTTAGGTAGAGGG + Intronic
1029390174 7:100269809-100269831 CTCAGAGTGCTTGGGGTGGCAGG + Intronic
1030599411 7:111576313-111576335 CTCAAACAACTGGGGATAGAAGG + Intergenic
1031003654 7:116447039-116447061 CACACACAGCTTGGTTTGGAAGG - Intronic
1031563260 7:123263689-123263711 CTCAAACAACTTTGGGGAGAAGG - Intergenic
1034100104 7:148443639-148443661 CTCAAATAACCTGGAGTGGAGGG - Intergenic
1034437335 7:151069442-151069464 GTCAAGAAGCTTGGGGCGGAGGG + Intronic
1035356154 7:158276987-158277009 CTCTAACAGGGTGGGGTGGGGGG + Intronic
1036283786 8:7425140-7425162 CTCAAATAGGTTGTGCTGGACGG + Intergenic
1036337687 8:7886390-7886412 CTCAAATAGGTTGTGCTGGACGG - Intergenic
1038205874 8:25464454-25464476 CTCAAACAGTTTGTGGTGCATGG + Intronic
1039677384 8:39684588-39684610 CTCAATCAGCCTGAGGTTGAGGG + Intronic
1041022928 8:53656795-53656817 CTTAAACAGGTGGGGATGGAGGG + Intergenic
1042428220 8:68673436-68673458 CTCCATCAGCTTGTGGTGAATGG - Intronic
1043030425 8:75127628-75127650 CTCAAATATCTTGGTGTTGAGGG + Intergenic
1045590385 8:103587728-103587750 CTCAAAAAACTGGGGATGGAAGG + Intronic
1045631058 8:104122394-104122416 CTCAAACATATAGGGCTGGAGGG + Intronic
1049496846 8:142939574-142939596 CGCAAACACCTTTGGCTGGACGG + Intergenic
1049562179 8:143317350-143317372 CTCAGACAGCTGAGGGTGGGAGG + Intronic
1050949024 9:11564755-11564777 CTCAAACAACTTGATATGGAAGG - Intergenic
1053365142 9:37517599-37517621 CTCAAACAGCCTGGGGTGGGAGG + Intronic
1058837240 9:108869035-108869057 CTCAAAGAGCAAGGGGTGGTAGG + Exonic
1062164305 9:135099239-135099261 CAAAAACAGCTTGGTGAGGACGG - Intronic
1185892207 X:3831827-3831849 CTCATACAGCTTAGGGGAGAAGG + Intronic
1185897314 X:3870246-3870268 CTCATACAGCTTAGGGGAGAAGG + Intergenic
1185902433 X:3908678-3908700 CTCATACAGCTTAGGGGAGAAGG + Intergenic
1187846599 X:23544658-23544680 CTCAAAAAACTGGGGATGGAAGG + Intergenic
1192312927 X:70031513-70031535 CTTACAGAGCTTGGGGTGGAAGG + Intronic
1192600609 X:72459708-72459730 CTCAAGCAGCTAGGGAGGGAGGG - Intronic
1192758577 X:74071257-74071279 CTCAAAAAGCTGGGGATAGAAGG - Intergenic
1193203921 X:78725665-78725687 CTCAGACAGCTTGTGGAAGAAGG + Intergenic
1193816036 X:86106276-86106298 CTCAAAAACCTGGGGATGGAAGG + Intergenic
1194048894 X:89042980-89043002 CTCAAAAGACTGGGGGTGGAAGG - Intergenic
1194361008 X:92950453-92950475 TTCAGTCAGCTTGTGGTGGATGG + Intergenic
1194392197 X:93333339-93333361 CTCAAACAGCTAGCTGTGGCTGG + Intergenic
1197214694 X:123857158-123857180 CTCAAACAGCATGTGGAGGCTGG - Intergenic
1197711922 X:129677904-129677926 CTCAGGCAGCTGGGTGTGGACGG - Intergenic
1197823547 X:130565404-130565426 GTCAGATAGATTGGGGTGGAGGG + Intergenic
1199255170 X:145711079-145711101 CACAAACACCCAGGGGTGGATGG - Intergenic
1200048269 X:153414028-153414050 CTCAGTAATCTTGGGGTGGAGGG + Intergenic