ID: 1104395427

View in Genome Browser
Species Human (GRCh38)
Location 12:128428281-128428303
Sequence CAGGGCATGAATGATGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104395423_1104395427 14 Left 1104395423 12:128428244-128428266 CCTATAAAACTTTTGGGAGTTTC 0: 1
1: 0
2: 3
3: 17
4: 187
Right 1104395427 12:128428281-128428303 CAGGGCATGAATGATGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 154
1104395422_1104395427 15 Left 1104395422 12:128428243-128428265 CCCTATAAAACTTTTGGGAGTTT 0: 1
1: 0
2: 1
3: 24
4: 269
Right 1104395427 12:128428281-128428303 CAGGGCATGAATGATGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104395427 Original CRISPR CAGGGCATGAATGATGTTCC TGG Intronic
904094720 1:27967697-27967719 CAAGGACAGAATGATGTTCCTGG - Exonic
906668621 1:47639011-47639033 AAGGGCATGAGTGGCGTTCCTGG - Intergenic
907298566 1:53470951-53470973 CAGGGCATGTGTGGTTTTCCGGG + Intergenic
907712018 1:56892174-56892196 AAGGACATGAATGTTATTCCTGG - Intronic
912179778 1:107205766-107205788 GAGGGCATGAGAGGTGTTCCTGG - Intronic
912662179 1:111541998-111542020 TATGGAATGAATGGTGTTCCTGG - Intronic
912907321 1:113720502-113720524 CAGTGCATGAATCATTTTCAGGG + Intronic
914995190 1:152537418-152537440 CAGGTTATGAAAGATATTCCAGG - Intronic
920493583 1:206438063-206438085 CAGGTCATGAAAGATGTCCTTGG - Exonic
921017709 1:211207528-211207550 CCGGGCATGGTTGATGTTCCAGG - Intergenic
921203909 1:212831860-212831882 CAGGGCATGAGGGATGACCCAGG - Intronic
922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG + Intronic
924446638 1:244138741-244138763 CTGGGCATGGGTGATGTTGCTGG - Intergenic
924746511 1:246839052-246839074 TAGCGCATGAATGATATTCTCGG - Intergenic
1062768899 10:84685-84707 CAAGGCAGGACTGATGCTCCAGG + Intergenic
1066142664 10:32523092-32523114 CAGTGCATGAATCATTTTCAAGG - Intronic
1067228248 10:44389281-44389303 CAGGACCTGGCTGATGTTCCAGG - Intergenic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1069015800 10:63427586-63427608 CCGGGCATGGTTGATGTTCCAGG - Intronic
1074445347 10:113517094-113517116 CTGGGCATGAATGATAATACAGG - Intergenic
1075532553 10:123242010-123242032 CAGGGCAGGAAGGAGGTGCCAGG - Intergenic
1077576948 11:3391129-3391151 CAGGGAAATACTGATGTTCCTGG + Intergenic
1079100718 11:17540332-17540354 CAGGGCGTGATTGCTGTGCCAGG - Intronic
1084636159 11:70394283-70394305 CCGGGGAGGAATGATGGTCCAGG + Intergenic
1085559749 11:77460358-77460380 AAGGCCATTAATGATGTTCATGG - Intronic
1085786866 11:79459953-79459975 AAGGGCTTGAATCATGTTCTGGG + Intergenic
1086063411 11:82722833-82722855 CAGGGCATAAATGAGGTCCTAGG - Intergenic
1086219450 11:84424823-84424845 CAGTGAATGAATGATATACCAGG + Intronic
1086633367 11:89051381-89051403 CAGGCCATGCAGGATGTTGCAGG + Intronic
1087500501 11:98945758-98945780 CAGGGCATTAATGATACTGCAGG - Intergenic
1087617456 11:100504776-100504798 AAGGGCATGAAGGTTGTTACAGG + Intergenic
1088159571 11:106854011-106854033 TTGGGCATGAGTGATGTTGCTGG + Intronic
1099949763 12:89288590-89288612 CAGAGCATGAAGGAGGTTTCTGG + Intergenic
1101596690 12:106172931-106172953 CAGGGCACCAATGACCTTCCAGG - Intergenic
1104395427 12:128428281-128428303 CAGGGCATGAATGATGTTCCTGG + Intronic
1110752425 13:79130571-79130593 AAGGGGAGGAAGGATGTTCCAGG - Intergenic
1113179517 13:107609291-107609313 CAAGGACAGAATGATGTTCCTGG - Intronic
1118092751 14:62500252-62500274 CAGTTCAAGAATGAAGTTCCCGG - Intergenic
1118525289 14:66633996-66634018 CAGGTCATGAATTGTTTTCCTGG + Intronic
1118763022 14:68892212-68892234 CATGGCATGCATGGTGTTCTCGG + Exonic
1120885034 14:89445414-89445436 CAAGGCATGATTGGTGTACCTGG - Intronic
1121386726 14:93534172-93534194 CAAGGCATGTATGCTATTCCTGG - Intronic
1124803359 15:32856958-32856980 CATGGAATGAAGGATGTTTCAGG + Intronic
1125035726 15:35121769-35121791 CCGGGCGTGGTTGATGTTCCAGG + Intergenic
1126371326 15:47950246-47950268 CAGGGGAGGACAGATGTTCCAGG - Intergenic
1128615168 15:69103199-69103221 GAGGGCATGAAGGATGTCCATGG - Intergenic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1130048574 15:80464785-80464807 CTGGCCATGAAGGATGTTCCTGG + Intronic
1130135140 15:81176215-81176237 CAGGGCCTGGAAGATGTTGCAGG + Intronic
1130150607 15:81308698-81308720 CAGTGCCTTGATGATGTTCCAGG - Exonic
1131252607 15:90840116-90840138 CGGGGCATCTATGATGTGCCAGG - Intergenic
1131310257 15:91284165-91284187 CAGGGCAGAAATGATGTTCCCGG - Exonic
1135990709 16:27217023-27217045 CAGGACTTGAAAGATGTTTCGGG + Intronic
1138920276 16:61519387-61519409 CAGGACAGAACTGATGTTCCAGG + Intergenic
1139341941 16:66273141-66273163 CAGGGCATGAATCTTGTCCGGGG - Intergenic
1141334788 16:83144541-83144563 CAGTGCATCTATTATGTTCCAGG - Intronic
1144169537 17:12646618-12646640 AAAGGTATGAATGATGTTTCTGG - Intergenic
1147304597 17:39554523-39554545 CAAGGCATGAATGGTTCTCCTGG - Intronic
1149097529 17:52861716-52861738 CAGGACATGCATGGTTTTCCAGG - Intergenic
1149632076 17:58134568-58134590 CAGGGCATAAGTGATGATCTTGG + Intergenic
1150144125 17:62753665-62753687 GAGGGCAAGAAAGATGTGCCTGG - Intronic
1155450801 18:25960683-25960705 CAGGGCAGTAATGCTGTACCTGG - Intergenic
1159144109 18:64431332-64431354 CTGGGCATGAATGATGATGATGG - Intergenic
1165001626 19:32768207-32768229 CAAGGACTGAATGATATTCCAGG + Intronic
1165797748 19:38528602-38528624 CCGGGCATGTAACATGTTCCTGG + Exonic
1165925067 19:39321277-39321299 CAGGGCATGATTTGTGGTCCTGG - Intergenic
1167637004 19:50661119-50661141 CAGAGAATGAATGATGTGCATGG + Intronic
925953138 2:8934899-8934921 CTGGGAATGAATGATGATCTTGG - Intronic
926634787 2:15167408-15167430 CAGGGCATGAATGATGATGAAGG - Intronic
929727398 2:44445115-44445137 CATGGCATAAATGAGGTCCCGGG + Intronic
930781775 2:55230944-55230966 TAGGGGATGAAAAATGTTCCAGG + Intronic
931328398 2:61252622-61252644 CAAGGAATGAAAGATGTTACAGG + Intronic
931566735 2:63622520-63622542 CCGGGCGTGGTTGATGTTCCAGG + Intronic
931802266 2:65770115-65770137 TATGGCATTCATGATGTTCCAGG + Intergenic
933936874 2:87213221-87213243 CCAGGCATGAATGAAATTCCTGG + Intergenic
934651066 2:96091667-96091689 CCGGGCCTGAGTGATGTCCCCGG - Intergenic
936356269 2:111752604-111752626 CCAGGCATGAATGAAATTCCTGG - Intergenic
937034666 2:118771075-118771097 CAGCTCATGGATGATGTTCATGG - Intergenic
939651834 2:144772674-144772696 CATAGAATGAATGAAGTTCCAGG - Intergenic
941730826 2:168915199-168915221 CAGGGCATGTGCAATGTTCCAGG + Intergenic
943369519 2:187001242-187001264 GAGGGCAGGAATGATATACCTGG + Intergenic
944126085 2:196294331-196294353 CAGGCCGTGAATGATCATCCTGG + Intronic
944761019 2:202813793-202813815 CGGGGCATGAAGGATGTACACGG + Intronic
944777906 2:202987765-202987787 CAGGGTGTGAATCATGTACCAGG + Intronic
945697169 2:213121510-213121532 CAGATCATGTATGATATTCCTGG + Intronic
947969040 2:234306579-234306601 CAGGGCATGTGTAAAGTTCCAGG + Intergenic
948612793 2:239180342-239180364 CAGGGCATCAATCCCGTTCCTGG + Intronic
1168954444 20:1825037-1825059 CAGGGAATGAATGACTTTCTGGG - Intergenic
1171263927 20:23755049-23755071 CAGCACATGAATGGTATTCCTGG + Intergenic
1173752722 20:45489554-45489576 AAGGACATGAAGGCTGTTCCTGG - Intergenic
1173899318 20:46575606-46575628 CAGGAGAAGGATGATGTTCCAGG + Exonic
1181803571 22:25362067-25362089 CAGGGCATGAGGGATGCTCTGGG - Exonic
1183685415 22:39358820-39358842 CAGGGCATGACTGCCCTTCCAGG - Intronic
1184642794 22:45881079-45881101 CAGGGCCTGAAGGAAGTCCCCGG + Intergenic
950851392 3:16065127-16065149 CAGGGAATTAATTATCTTCCTGG + Intergenic
951104820 3:18730511-18730533 CTGGGTATAAATGATGTTGCTGG - Intergenic
951708779 3:25569103-25569125 AAGGGAATGAATGGTTTTCCAGG + Intronic
951767659 3:26217414-26217436 CAGGGCATGCATGATGAGGCTGG + Intergenic
954093286 3:48301810-48301832 CTGGGCATCAACCATGTTCCAGG - Intergenic
954640632 3:52095732-52095754 CAGGGAATGAGTGAAGCTCCAGG - Intronic
954838468 3:53491915-53491937 CAGGGCATAAATGATGTATGAGG - Intergenic
955107415 3:55911657-55911679 CAGAGCATGAATGAGATTTCAGG + Intronic
956145750 3:66189124-66189146 CAGTGTATGAATGAAGTTCAAGG - Intronic
956189398 3:66594391-66594413 AAGGGCATGAAGGACGTTTCTGG + Intergenic
958728117 3:97931002-97931024 CAAGGCAAAAAGGATGTTCCAGG - Intronic
959254403 3:103991388-103991410 CATGGCATAAATGAGGTTCCGGG - Intergenic
961622208 3:128233045-128233067 CAGAGCATTAATGATGCGCCAGG - Intronic
961709686 3:128818492-128818514 CATGGCTAGAATGATGTTCAAGG - Intergenic
962166496 3:133054727-133054749 CAGGGTAAGAATGATGGTCCTGG + Intronic
963052652 3:141155039-141155061 CAGGGCCTGAATGAAGTCCATGG + Intergenic
964153156 3:153553005-153553027 CAGGTCATGATTGAAATTCCAGG - Intergenic
964288775 3:155152208-155152230 CAGGGCATAAAGGGTGGTCCAGG - Intronic
967142134 3:186570307-186570329 CTGGGTATGAATGAAATTCCGGG + Exonic
968752923 4:2399553-2399575 CTGGGTATGTATGATGTGCCAGG - Intronic
973084259 4:46035186-46035208 CAGGGGATGACTGCTGTTTCTGG - Intergenic
978373225 4:108050203-108050225 CAGGGAATGGTTGATTTTCCAGG - Intronic
985208127 4:187562636-187562658 CAGGGAGAGAATGATGTTCACGG - Intergenic
988043262 5:25914627-25914649 TAGTGCATGAATGATGGTGCAGG - Intergenic
988327229 5:29786192-29786214 CAGGAAAAGAATGATGTTCCAGG + Intergenic
990134565 5:52630170-52630192 CAGGTCATGAATCATTTTACTGG + Intergenic
993014167 5:82516956-82516978 CACAGCATGAATGATGTCCCTGG + Intergenic
998467875 5:142360358-142360380 CAGGTCATGAATGAAATGCCAGG - Intergenic
998950536 5:147389235-147389257 CAGGGCATGAATGTTTTGCCTGG - Intergenic
1001640168 5:173238443-173238465 CAGCGCATTAATGACATTCCCGG - Intergenic
1001670973 5:173473703-173473725 CTGTGCATGAATGAGGTTACAGG + Intergenic
1002159177 5:177304822-177304844 CCGGGCGTGGTTGATGTTCCAGG - Exonic
1003543380 6:7037772-7037794 CTGGGGCTGAATGATCTTCCAGG - Intergenic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1008871521 6:56277976-56277998 CAGCAAATGAAAGATGTTCCAGG - Intronic
1009390991 6:63143661-63143683 CAGCACATGGATGATGTTCAAGG + Intergenic
1014874776 6:126643929-126643951 CCGGGCGTGGTTGATGTTCCAGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016111525 6:140230744-140230766 CAGAGCTTGAATGCTGTGCCAGG - Intergenic
1016366340 6:143322548-143322570 CAGGTCATGAATGTTATTCAGGG + Intronic
1017413680 6:154196365-154196387 TAGAGCATGCATGATGTTTCAGG - Intronic
1018786697 6:167113954-167113976 CAGGGCAAGGAAGAGGTTCCAGG + Intergenic
1019164924 6:170091735-170091757 CAGGGCATGGATGGGGTTTCCGG - Intergenic
1019190956 6:170250409-170250431 CAGGGCATGACTGAATTTTCAGG - Intergenic
1020370962 7:7431604-7431626 CGGGGCATGAAGGATCTTCAAGG + Intronic
1029031902 7:97477526-97477548 TTGGACATGAGTGATGTTCCAGG + Intergenic
1029546184 7:101211777-101211799 CAGGGCAGGAGTGGGGTTCCCGG + Intronic
1029964832 7:104728532-104728554 ATTGGCATGAAAGATGTTCCAGG - Intronic
1030380832 7:108810154-108810176 AAGAGCATGAATGATGTTTCAGG + Intergenic
1030405002 7:109099719-109099741 CAGGGGAGGAGTGTTGTTCCGGG - Intergenic
1031293203 7:119965817-119965839 CAGGACATAAATGTGGTTCCTGG + Intergenic
1032672455 7:134097819-134097841 CAGGGCCTGGAAGATGTTCATGG + Intergenic
1032784893 7:135193271-135193293 AAGGGCATGAACCAGGTTCCTGG - Exonic
1041003970 8:53481475-53481497 CAGAGCAGGAATTGTGTTCCTGG + Intergenic
1041722359 8:60987698-60987720 CTGGGCATGAATGAAGTGTCAGG - Intergenic
1045546740 8:103136251-103136273 CAGGGCATGAATGGTACACCTGG - Intronic
1045675570 8:104604262-104604284 CAGTCCATGAATGATATTCATGG - Intronic
1046425255 8:114039341-114039363 CAGTGCATGAAAGATTTTCCAGG + Intergenic
1047615475 8:126558803-126558825 TAGGGCAAGAAATATGTTCCAGG - Intergenic
1051104760 9:13566756-13566778 AGGGGCAGGATTGATGTTCCGGG + Intergenic
1052258808 9:26491192-26491214 CAGGTGATGAATGCTGTGCCAGG + Intergenic
1055012754 9:71585178-71585200 CAGGGAATGAATGATGCACTTGG - Intergenic
1056684549 9:88748761-88748783 CAGGGAATGTGTGCTGTTCCAGG - Intergenic
1056729745 9:89155410-89155432 CTGGGCAAGAATGATGGTCTTGG + Intronic
1059773041 9:117445709-117445731 AAGGACATGGATGATTTTCCGGG + Intergenic
1060388820 9:123260173-123260195 CAGGGGAATAATGATGTTGCAGG + Intronic
1060973134 9:127750100-127750122 CAAGGCAGGAAGGGTGTTCCAGG - Intronic
1061434025 9:130549324-130549346 CAGAGCATGAAGGATGGTGCAGG - Intergenic
1185755427 X:2649743-2649765 CTGTGCATGAGTGATGTTACAGG + Intergenic
1188832632 X:34918863-34918885 CAGGACATGGATCATGGTCCAGG - Intergenic
1190538200 X:51449895-51449917 GAGGGCAACAATGATGTTTCAGG - Intergenic
1194010220 X:88552956-88552978 CAGGTCTTGAATGATTTTACTGG + Intergenic
1200398393 X:156004480-156004502 CAAGGCAGGACTGATGCTCCAGG - Exonic