ID: 1104399138

View in Genome Browser
Species Human (GRCh38)
Location 12:128461297-128461319
Sequence ACAAGGAGCATTGTGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104399129_1104399138 21 Left 1104399129 12:128461253-128461275 CCAGACAAGGGACATAGAACTGT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1104399138 12:128461297-128461319 ACAAGGAGCATTGTGGGTGGGGG 0: 1
1: 0
2: 3
3: 23
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104399138 Original CRISPR ACAAGGAGCATTGTGGGTGG GGG Intronic
900594344 1:3473698-3473720 ACAGTGAGCTCTGTGGGTGGCGG - Intronic
903311254 1:22458364-22458386 ATAAGGTGAATTGTGGGAGGAGG - Intronic
903845208 1:26275780-26275802 ACATGGCCCAGTGTGGGTGGAGG + Intronic
905015902 1:34778231-34778253 GCAAGGAACATTTGGGGTGGGGG + Intronic
905917917 1:41698750-41698772 AGCAGAAGCATTGTGGGGGGTGG - Intronic
906210560 1:44010439-44010461 ACAGGGAGCCTTGTGGGCGGGGG + Intronic
906645148 1:47469383-47469405 TCAAGAAGAATGGTGGGTGGTGG + Intergenic
907861429 1:58357369-58357391 TTAAGGAACATGGTGGGTGGTGG + Intronic
908395956 1:63725820-63725842 CCAAGGAGCATGGTGGGAGTGGG - Intergenic
909687067 1:78361763-78361785 GCAGGCAGCATTGTGTGTGGGGG + Intronic
909876212 1:80807115-80807137 ACAAAGAGACTTGTGTGTGGAGG + Intergenic
910851595 1:91654667-91654689 ACAAGGAACAGTGTTGGAGGTGG - Intergenic
914918916 1:151834463-151834485 ACAAAGGCCACTGTGGGTGGAGG + Intergenic
916217544 1:162410274-162410296 CCAAGGAGCAGTGTGGCTGTCGG - Intronic
916931538 1:169583162-169583184 ACAGGGAGAGTTGTGAGTGGTGG + Intronic
917826199 1:178823757-178823779 AGAAGGACCATTGTGGGCTGGGG + Intronic
917951609 1:180043603-180043625 ATAAAGACCATTGTGGCTGGAGG + Intronic
919112284 1:193236231-193236253 ACAAGTAGAAAAGTGGGTGGGGG - Intronic
920605145 1:207375133-207375155 CCAAGGAGGAGTGTGGGTGCGGG + Intergenic
921264753 1:213412889-213412911 AGAAAGAGCACTGTGGCTGGGGG - Intergenic
921287723 1:213623987-213624009 AAAAGCAGCATTGTGTGTGGAGG + Intergenic
923434161 1:233952877-233952899 ACAAAGAGAATTGTGGGGCGGGG - Intronic
924701889 1:246462518-246462540 ACATGCAGTTTTGTGGGTGGTGG - Intronic
1064114654 10:12567966-12567988 ACATGGCACATTGTAGGTGGGGG + Intronic
1067822193 10:49539980-49540002 ACAAGTTACATTGTGGGTTGGGG - Intergenic
1069230425 10:66002584-66002606 TCCAGGCGAATTGTGGGTGGTGG + Intronic
1070225979 10:74506250-74506272 GTAAGGACCATTGTGGTTGGGGG - Intronic
1070330464 10:75413018-75413040 AGAAGGAGGATTGTTGGTGATGG - Intergenic
1071775932 10:88788092-88788114 TCAAGAAGCATTTAGGGTGGGGG - Intergenic
1072017869 10:91367349-91367371 ACAGGGAGCAAAGGGGGTGGGGG - Intergenic
1072899821 10:99397237-99397259 AAAAGGAGTGTTGTGTGTGGCGG - Exonic
1072977741 10:100074035-100074057 ACCTGGAGTATTGTGGGGGGGGG - Intronic
1074409586 10:113214728-113214750 ATAAGAAGCATTGTGGGGGTTGG - Intergenic
1074577607 10:114685141-114685163 AAAAGTTGGATTGTGGGTGGTGG - Intergenic
1074960855 10:118444529-118444551 ACAAGAAACATTTGGGGTGGGGG - Intergenic
1075803754 10:125170355-125170377 ACAAGGAACATCTTGGGTGCAGG - Intergenic
1076297022 10:129393959-129393981 ACAGGATGCAGTGTGGGTGGTGG + Intergenic
1076313188 10:129522463-129522485 ACAAAGAGCACTGTGGGATGGGG - Intronic
1076345922 10:129778926-129778948 ACAAGAAGCATTGGGTGTTGGGG + Intergenic
1076469518 10:130708737-130708759 ACAAGGTGCACCGTAGGTGGTGG + Intergenic
1076512758 10:131024064-131024086 GCAGGGAGCATGGTGGGTGCTGG + Intergenic
1076798022 10:132808195-132808217 ATAAGGAGAATCATGGGTGGTGG - Intergenic
1076838542 10:133033303-133033325 CCAAGGAGCATGGAGGGTGGAGG - Intergenic
1077079810 11:720246-720268 ACAGGGAGCACAGTGGGTAGAGG + Intronic
1077606807 11:3617802-3617824 ACCCGGAGCATTGTGTGTTGCGG + Intergenic
1078090819 11:8263327-8263349 ACAAGGAGGACGGTAGGTGGCGG - Exonic
1078815705 11:14820477-14820499 TGAAGGAACATTTTGGGTGGGGG + Intronic
1078909642 11:15718918-15718940 AAAGGGAGCATTGTGGGGTGGGG - Intergenic
1080025667 11:27611617-27611639 AGAAAGAGCATTTTGGGTGGAGG - Intergenic
1080927522 11:36773405-36773427 TCATGGACTATTGTGGGTGGTGG - Intergenic
1081962791 11:47150689-47150711 ACAGGGAGCATTATGGCTAGAGG + Intronic
1084312966 11:68327210-68327232 AGAAGGGGCAGTGTGGGTGCTGG + Intronic
1085401935 11:76240770-76240792 AGAAGGGGCATTCCGGGTGGAGG + Intergenic
1086410461 11:86539736-86539758 ACAAAGAATAATGTGGGTGGTGG - Intronic
1086496507 11:87409851-87409873 ACACATAGCATTGTGGGGGGTGG - Intergenic
1088747600 11:112817445-112817467 AGAAGAAGGATTCTGGGTGGAGG - Intergenic
1089132632 11:116224451-116224473 ATAAGGAGGGTTGGGGGTGGGGG - Intergenic
1089315273 11:117587162-117587184 ACTAGGAGGAGTGAGGGTGGTGG - Intronic
1089319907 11:117618728-117618750 ACAAGGAGCAGGGAGGGAGGGGG + Intronic
1089612797 11:119678812-119678834 ACAGGGAACTGTGTGGGTGGGGG - Intronic
1090065458 11:123499489-123499511 GCAAGGAGAAAGGTGGGTGGAGG + Intergenic
1090680251 11:129048069-129048091 ACAAGGAGAGTGGGGGGTGGGGG - Intronic
1091175637 11:133554966-133554988 GCAAGGAGCATGTGGGGTGGGGG - Intergenic
1094047693 12:26185478-26185500 ACAAGGTGCTGTGTGAGTGGGGG - Intronic
1094484555 12:30914321-30914343 ACAAGGAGACTTGGTGGTGGTGG + Intergenic
1096650298 12:53059145-53059167 ACAGAGAGCATGGGGGGTGGTGG - Exonic
1096693927 12:53337017-53337039 ACAAGCAGGAGTGAGGGTGGCGG + Intronic
1096875123 12:54623382-54623404 ACCAGGAGCACAGTGGGTGAAGG - Intergenic
1098445666 12:70563447-70563469 AGAAAGAGCATTTGGGGTGGAGG - Intronic
1101767553 12:107716263-107716285 AAAAGGATCTTTTTGGGTGGTGG + Intergenic
1103728324 12:123010122-123010144 ACATGGAGAGATGTGGGTGGGGG - Intronic
1104399138 12:128461297-128461319 ACAAGGAGCATTGTGGGTGGGGG + Intronic
1107996255 13:45864164-45864186 ACAAGGAGGGTGGTGGGAGGGGG + Intergenic
1108388077 13:49919924-49919946 AATAGCAGCATTGGGGGTGGGGG + Intronic
1108427917 13:50324045-50324067 AGAATGAGCAATGTGGGTGTTGG + Intronic
1113311789 13:109140111-109140133 CCAGGGAGCCTAGTGGGTGGAGG + Intronic
1117343064 14:54808091-54808113 AAAAGGAGCTTTGCTGGTGGAGG - Intergenic
1118919085 14:70133491-70133513 ACAAGGTGCATTGAGGCTGCAGG + Intronic
1119513409 14:75229348-75229370 GCAGAGAGCATGGTGGGTGGGGG + Intergenic
1119725643 14:76920441-76920463 AGAAGGAGCACTGGAGGTGGGGG - Intergenic
1120016150 14:79476049-79476071 ACAAGGAGCAGTGTAAGCGGTGG - Intronic
1120856456 14:89216814-89216836 ACAATGAGGATTGTGGATTGTGG - Intronic
1121011974 14:90525097-90525119 GCAAGGAGACTTGGGGGTGGAGG - Exonic
1125394036 15:39227290-39227312 TCATGGAGGATGGTGGGTGGGGG + Intergenic
1126518161 15:49558205-49558227 GCAAGGAGCAGTGTGGGTAGGGG - Intronic
1126865859 15:52935928-52935950 AGAAGGAGCCTTGAGGATGGAGG + Intergenic
1128563517 15:68683842-68683864 GGAAGGAGCATTGGAGGTGGAGG + Intronic
1128937059 15:71755906-71755928 GGAAAGAGCATTCTGGGTGGAGG + Intronic
1128998905 15:72317248-72317270 AAAAGGAGCATTCTGAGTGTAGG + Intronic
1130705776 15:86231875-86231897 AGAAGGATTATTGTGGGAGGGGG + Intronic
1130933166 15:88447034-88447056 CAAAGGAACTTTGTGGGTGGTGG + Intergenic
1132320401 15:100920653-100920675 ACAAGGGGCAGGGTGGGGGGTGG - Intronic
1134004560 16:10809559-10809581 AAAAGGAGCTATGTGGGTGCAGG + Intronic
1134123554 16:11601115-11601137 AAAAGGAGGAGTGAGGGTGGGGG - Intronic
1134424662 16:14128914-14128936 ACAAGGAGATTTTTGGGTGATGG - Intronic
1136251456 16:29008336-29008358 ACAAGGAGCGTGGTGGGCAGTGG + Intergenic
1137589653 16:49685802-49685824 TCTAGGAGCAGTGTGGGTGGTGG - Intronic
1137667744 16:50261595-50261617 ACAAGGCACATGGTGGGTGCTGG - Intronic
1137948455 16:52758456-52758478 AGCAGGTGCATTGGGGGTGGAGG - Intergenic
1138330612 16:56212365-56212387 TCCAGGACCATTGCGGGTGGAGG - Intronic
1141690282 16:85592864-85592886 ATTCGGAGCAGTGTGGGTGGGGG + Intergenic
1141750516 16:85955093-85955115 CCAGGGAGCAGTGTGGGTGAAGG + Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1143457657 17:7078235-7078257 ACAAGGAGGATTTTGGGGTGGGG + Intronic
1143828367 17:9631181-9631203 ACATGGAGCCTTGTAGGTGATGG - Intronic
1144150399 17:12437656-12437678 ACAAGGTCCAGTGGGGGTGGGGG - Intergenic
1144675782 17:17160756-17160778 ACAGGGACCACTGTGAGTGGTGG - Intronic
1147595095 17:41711966-41711988 ATAGGGACCTTTGTGGGTGGTGG - Intergenic
1147927934 17:43956664-43956686 ACAAGGAGAATTGTTGGCTGGGG - Intronic
1148923984 17:51065806-51065828 GCATGGAGCATCGTGTGTGGAGG - Intronic
1150905789 17:69335564-69335586 ACAAGGAGCTTGGAGGGTGGAGG - Intergenic
1151538722 17:74753320-74753342 CCAGGGAGCAAGGTGGGTGGTGG + Intronic
1152060482 17:78070499-78070521 AGAAAGAGCAGTGGGGGTGGGGG - Intronic
1152696640 17:81800887-81800909 CCAAGCAGCAGTGGGGGTGGGGG - Intergenic
1156765885 18:40654457-40654479 AGAAAGAGCATTGTAGGAGGCGG - Intergenic
1156857648 18:41801205-41801227 TCAAGGAGATTTGTGGGTGATGG + Intergenic
1156857755 18:41802291-41802313 CCAAGGAGATTTGTGGGTGATGG + Intergenic
1156926222 18:42583365-42583387 TCCATGAGGATTGTGGGTGGGGG - Intergenic
1158010510 18:52722374-52722396 AGAAGGAATATTGAGGGTGGAGG - Intronic
1160887303 19:1355790-1355812 AAAAGGAGGTTTGGGGGTGGGGG - Intronic
1161055567 19:2189200-2189222 TCACAGAGCAGTGTGGGTGGGGG + Intronic
1161587033 19:5111169-5111191 ACAGGGAGCCATGTGGCTGGTGG - Intronic
1165180614 19:33964252-33964274 ACTAGCTCCATTGTGGGTGGGGG - Intergenic
1165761386 19:38323375-38323397 ACGAGGGGCATTGTGGGAAGAGG - Intronic
1166831988 19:45644715-45644737 AGAAGGACCACTGTGGGTGTCGG - Intronic
1168654388 19:58117201-58117223 ACAAAGAGGATTGTGGGTGGAGG + Intronic
926787858 2:16536267-16536289 TCAAGGAGCAGGGTGGGTGTTGG + Intergenic
928200464 2:29244666-29244688 ACATGGAGCATCGGTGGTGGAGG + Intronic
928331584 2:30361703-30361725 GCAGGAAGCATTGGGGGTGGGGG - Intergenic
928735199 2:34280177-34280199 AAAAGGAGCAATGGGGGTGAGGG + Intergenic
932779599 2:74551818-74551840 ACAAGTATGAGTGTGGGTGGTGG - Intronic
934507759 2:94907653-94907675 ACAAGGTCTACTGTGGGTGGAGG + Intergenic
934554936 2:95282096-95282118 ACGATGAGCCTTGGGGGTGGCGG - Intronic
937487959 2:122335433-122335455 ACAAGGAGAATAGTGGGAGATGG + Intergenic
938396872 2:130957491-130957513 TGAAGGAACATTTTGGGTGGGGG + Intronic
938406955 2:131038144-131038166 TGAAGGGGCATTGTGGTTGGTGG + Intronic
940212377 2:151268420-151268442 ACAAGAATCATGGAGGGTGGAGG - Intergenic
940416815 2:153432616-153432638 ACAAGCAGCACTGGGGGTGGGGG - Intergenic
941915893 2:170813762-170813784 ATAAAGGGCATTGTGGGCGGAGG + Intronic
942518304 2:176776345-176776367 AGGAGGGGCATTGTGGGTGCTGG - Intergenic
943550738 2:189336727-189336749 ACAGGGAGCATTCTGGGTGATGG + Intergenic
944235095 2:197435162-197435184 GCGAGGTGCATTGTGGGTGGGGG + Intergenic
944678548 2:202054964-202054986 ACCAGGTGCATTGTGGCTGGAGG - Intergenic
944801397 2:203240637-203240659 AGAAAGAGCATTCTGGGTCGAGG + Intronic
945192799 2:207207566-207207588 TCAAGGAGCAGTGTTGGGGGAGG - Intergenic
945334289 2:208573254-208573276 ACAAGGAGAATGATTGGTGGAGG - Intronic
945811862 2:214558618-214558640 GCAAAGATAATTGTGGGTGGTGG - Intronic
947322584 2:228938505-228938527 AAAAGGAGGGTTGTGGGTGAGGG + Intronic
948134941 2:235629409-235629431 GCAAGGAGGAAAGTGGGTGGTGG + Intronic
948424015 2:237876600-237876622 AGAAGAAGCCTGGTGGGTGGGGG + Intronic
948484451 2:238271604-238271626 ACCAGGAGCGTTGGAGGTGGGGG + Intronic
948518088 2:238518866-238518888 ACAAAGAGCAGAGTGGGAGGAGG - Intergenic
948683470 2:239654571-239654593 AAATGCAGCATTGTAGGTGGTGG - Intergenic
948741815 2:240053360-240053382 ACAGGGTGCATTGTGAGTGCAGG - Intergenic
1169425381 20:5492859-5492881 ACAAGGTGCATTTTGGGGGCAGG + Intergenic
1171895315 20:30752991-30753013 ACAAGGTCTACTGTGGGTGGAGG + Intergenic
1172302659 20:33860957-33860979 ACAAGGAGCTTTGTGAGAGCGGG - Intergenic
1172628153 20:36360581-36360603 CCATGGCGAATTGTGGGTGGCGG + Intronic
1172794151 20:37525586-37525608 ACATGAAGTTTTGTGGGTGGAGG - Intronic
1173414810 20:42846072-42846094 ACACGGAGGCTGGTGGGTGGTGG - Intronic
1173691081 20:44961647-44961669 AAAGGGAGCATAGTGGGGGGTGG - Intergenic
1174384393 20:50178497-50178519 CCAAGGAACATGGTGGATGGCGG + Intergenic
1176059076 20:63164318-63164340 ACAACCAGTTTTGTGGGTGGCGG + Intergenic
1177845818 21:26286296-26286318 ACATTGAAAATTGTGGGTGGAGG - Intergenic
1178241003 21:30900666-30900688 CCAAGGAGCAGTGTGGGGGTCGG + Intergenic
1180083032 21:45495170-45495192 ACAAGGACCCTTTTGGGAGGAGG - Intronic
1180381657 22:12143958-12143980 ACAAGGTCTACTGTGGGTGGAGG + Intergenic
1180732735 22:17994194-17994216 ACAAGGAGCTTTGTTGGTGGAGG + Intronic
1181517484 22:23423513-23423535 ACAAGGAGCTTTGGCAGTGGAGG + Intergenic
1182311269 22:29409502-29409524 ACAAGGAGCCTTGGGGGATGTGG - Intronic
1182689707 22:32150529-32150551 ACAAGGAGCCTTGGGGGATGTGG + Intronic
1183066399 22:35366436-35366458 ACCATGGGCAATGTGGGTGGAGG + Intergenic
1183977677 22:41522809-41522831 ACCTGGTGCATTGTGGGTGGTGG - Exonic
1184181073 22:42826691-42826713 AAATGCAGCATTGTGGCTGGGGG - Intronic
1184446524 22:44550735-44550757 ACAATGAGCATTGTGGGAGGAGG + Intergenic
1185033852 22:48460656-48460678 AGAAGGAGCATTGAGGCTGGGGG - Intergenic
1185120317 22:48962400-48962422 ACAAGCAGCAGGGTGGATGGGGG + Intergenic
949195933 3:1307474-1307496 ACAAGGGAAATTGTGTGTGGGGG - Intronic
951750476 3:26028957-26028979 ATTTGGAGCATCGTGGGTGGAGG + Intergenic
951774378 3:26292928-26292950 CCAAGGAACTTTGTGGGTGATGG + Intergenic
953158770 3:40398966-40398988 ACCAGCAGCATTTTGGGAGGCGG + Intronic
953750351 3:45603952-45603974 ACAAGGAGCGTCCTGGGTGATGG - Intronic
954030405 3:47815508-47815530 CCATGCAGCATTGTGGATGGTGG + Intronic
954217756 3:49133798-49133820 AGAAGGAGGAAAGTGGGTGGGGG + Intergenic
955071450 3:55575651-55575673 ACAGGGATCATGGTGGCTGGTGG - Intronic
956472820 3:69586087-69586109 ACTAGTAGCTTTGTTGGTGGAGG + Intergenic
961039835 3:123670233-123670255 AAAAGGAACACTGTTGGTGGAGG + Intronic
961549973 3:127664153-127664175 GCAAGGAGAATGGTGGGTGCCGG - Intronic
961737453 3:129010882-129010904 ACAGGGGGCTTGGTGGGTGGGGG + Intronic
961955581 3:130799618-130799640 AGAAGGAGGATGGTGGGAGGTGG + Intergenic
962291019 3:134136458-134136480 TCAAGCAGCATGGTGGGTAGTGG - Intronic
962846323 3:139277291-139277313 ACATGAAGCATAGTGTGTGGAGG + Intronic
962877856 3:139549598-139549620 ACAAGGACCTTGGTGAGTGGAGG - Intergenic
963362042 3:144286900-144286922 ATAAGGACCATTGAGGGTTGAGG + Intergenic
964585555 3:158295246-158295268 AAAAGGAGCATTTTAGGTAGGGG + Intronic
965281169 3:166754787-166754809 ACAAGGAGCATAGAGGGAGCTGG - Intergenic
965953416 3:174338343-174338365 ACAAGGGACATTGTGGGATGTGG - Intergenic
966528619 3:180947884-180947906 ACCAAGAGCCATGTGGGTGGTGG + Exonic
967259064 3:187624042-187624064 ACAAGGAGCATGGTGAGGGTGGG - Intergenic
967408858 3:189147352-189147374 ACCTGGAGCATTGTGGATGCAGG + Intronic
968220099 3:196930889-196930911 ACAAGGAGCTATGTGAGTGCCGG + Exonic
968440582 4:622004-622026 ACAGGGGTCTTTGTGGGTGGGGG - Intergenic
969409801 4:7020444-7020466 ACAGGGAGCCCTGTGGTTGGGGG + Intronic
969866566 4:10080290-10080312 ACATGGGGCTTTGTGGGTGAGGG - Intronic
969911116 4:10447381-10447403 ACAGTGAGCATTGTGGCTGCTGG + Intronic
973371580 4:49252486-49252508 ACAAGGTCTACTGTGGGTGGAGG + Intergenic
973389427 4:49542825-49542847 ACAAGGTCTACTGTGGGTGGAGG - Intergenic
979276089 4:118815578-118815600 ACCAGGACCATTGAGTGTGGTGG + Exonic
981477088 4:145197958-145197980 ACAAGAGGCATTATAGGTGGTGG - Intergenic
981744779 4:148042122-148042144 ACAAGGAGCATACTGGGTGAGGG - Intronic
982292842 4:153796089-153796111 AAAAGAAGCATTTGGGGTGGGGG - Intergenic
982309849 4:153973553-153973575 AGAAGGAGCCTGGTGGGAGGTGG + Intergenic
985006273 4:185537835-185537857 ACAAGCATCATTCTGGGAGGTGG + Intergenic
985055194 4:186030074-186030096 GCAAGGAGCATTGTGAGAGCTGG + Intergenic
987652457 5:20760287-20760309 ACAGCAAGCATTCTGGGTGGTGG + Intergenic
987840632 5:23218900-23218922 AAAAGGATCATGGTGGTTGGAGG - Intergenic
988743102 5:34101196-34101218 ACAGCAAGCATTCTGGGTGGTGG - Intronic
989689819 5:44127905-44127927 ACAAGTAGAATTGTGTGTAGAGG - Intergenic
990603840 5:57387520-57387542 ACAATGAACATTGTCGGTGATGG - Intergenic
990827778 5:59921808-59921830 ACAAGGAGGATGATTGGTGGAGG - Intronic
995898700 5:117044708-117044730 CCAAGGAGCAGGGTGGGTGTTGG - Intergenic
996282009 5:121741389-121741411 AGAAGGAGCAATGTTGGTGGCGG + Intergenic
997193724 5:131963373-131963395 CCAAGGTGCATTGTCAGTGGCGG - Intronic
997693174 5:135841693-135841715 ACTAGGAGATGTGTGGGTGGGGG + Intronic
998003130 5:138640122-138640144 AGAAGAGGCACTGTGGGTGGCGG + Intronic
998153231 5:139769172-139769194 AGAAGGAGCATGGTGGGAAGAGG + Intergenic
999889064 5:155957172-155957194 GGAAGGAGCATTTTGGATGGAGG + Intronic
1000174068 5:158733188-158733210 GCAATTAGCATTATGGGTGGGGG - Intronic
1000348680 5:160335467-160335489 TGAAAGAGCATTTTGGGTGGAGG - Intronic
1001537145 5:172506052-172506074 GCCAGGAGCATTGGGGGTGGGGG - Intergenic
1006807596 6:36798643-36798665 ACAGGGAGCCTTCTGGGTGCTGG + Intronic
1007170283 6:39857943-39857965 ACAGGGAGCATTCTGGGGGTGGG + Intronic
1008842520 6:55920979-55921001 AAAAGCAGCGTTGGGGGTGGGGG + Intergenic
1011053306 6:83177925-83177947 CCAAGGAGCAGGGTGTGTGGGGG - Intronic
1014712075 6:124818181-124818203 ACAATGAGCAGTGGGGGAGGGGG + Intronic
1014974276 6:127859714-127859736 ACAAGGAGTAATGAGGGTAGTGG + Intronic
1015535925 6:134267677-134267699 ATCAGGATCATTGCGGGTGGAGG + Intronic
1017239029 6:152147056-152147078 GGAAGGAGCACTGTGGGTGCAGG - Intronic
1019355454 7:576536-576558 ACAATGAGCATTCTGGGACGTGG + Intronic
1019864684 7:3696223-3696245 ACAAGGACCACAGTGAGTGGTGG - Intronic
1022136851 7:27457281-27457303 CCAAGGCGCTTTGGGGGTGGAGG - Intergenic
1023940921 7:44767974-44767996 ACAAGAAGCAGGCTGGGTGGGGG - Exonic
1025614568 7:63106713-63106735 AAAAGGAGCTTTGCTGGTGGAGG + Intergenic
1026320021 7:69260087-69260109 ACAGAGGGCATTGTAGGTGGAGG - Intergenic
1026384262 7:69830221-69830243 ACCAGGAGCAGTGTGGGAGGAGG + Intronic
1026926289 7:74196168-74196190 CCAAGGCGCTTTGGGGGTGGAGG + Exonic
1027452669 7:78350835-78350857 ACAGGGAGCATTGATGGTGAGGG - Intronic
1028041394 7:86058717-86058739 GCAAGGAGCAGTGGGGGTGGGGG + Intergenic
1028183187 7:87749661-87749683 AAAAGCAGCAATGTGGGGGGAGG - Intronic
1030155635 7:106451542-106451564 ACCAGGAGCATAGTGGGGGTAGG + Intergenic
1030737146 7:113062752-113062774 AGCAGGAGCATTGTTGGAGGTGG - Intergenic
1032062964 7:128739832-128739854 ACAAGCAGGATGGTGAGTGGAGG - Intronic
1032215127 7:129952042-129952064 TCAAGCAGCATTGTGGTTGGAGG + Intronic
1032225933 7:130031847-130031869 CCAAGGAGCTCTGTGTGTGGTGG - Intronic
1032359154 7:131238852-131238874 ACATGGAGGATTGTGTGGGGAGG + Intronic
1033156099 7:138958294-138958316 AGAATGAGCATCGTGGGTGATGG - Intronic
1034685245 7:152965559-152965581 ACAAAGAGCTGTGTGGTTGGTGG - Intergenic
1036210471 8:6836339-6836361 CCAAGGAGCAGTGTGGGGGACGG + Intergenic
1036523046 8:9510047-9510069 ATAAGTAGCCTTGTGGGTGGAGG + Intergenic
1039395133 8:37219312-37219334 AGAAGAGGCATTGTGGGTGCTGG + Intergenic
1041532055 8:58880150-58880172 ACAAGAAGCCTTGAGGGTGGAGG + Intronic
1045298137 8:100889867-100889889 AGAAGCAGCATGGCGGGTGGAGG + Intergenic
1046834970 8:118790191-118790213 TCAAGCAGCATTCTGGGAGGTGG - Intergenic
1047429974 8:124782683-124782705 ACCAGGAGTGTTGTGTGTGGAGG - Intergenic
1049579484 8:143404808-143404830 CCAAGGAGCCCTGTGGGTGGTGG + Intergenic
1049769366 8:144372816-144372838 ACGAGGAGCCATGTGGGAGGAGG + Intergenic
1050095126 9:2056928-2056950 AAATGGACCCTTGTGGGTGGTGG + Intronic
1050430220 9:5554536-5554558 ACGAAGAGTATGGTGGGTGGAGG + Intronic
1051102321 9:13535443-13535465 AGTAGGTGCATTGTTGGTGGGGG + Intergenic
1054353334 9:64039777-64039799 ACAAGGTCTACTGTGGGTGGAGG - Intergenic
1054855720 9:69897723-69897745 ACAAGGGGCAATGGGGGTGGAGG + Intronic
1055869230 9:80854500-80854522 ACAAGGTCTATTGAGGGTGGAGG - Intergenic
1057433502 9:95017760-95017782 ACAAGGAACTTTCTGGGTGATGG - Intronic
1060912941 9:127365145-127365167 CCAATGTGCATTGTGGGTGCTGG + Intronic
1061486541 9:130923310-130923332 AAAAGGAGGAGTGTGGCTGGAGG - Intronic
1061956250 9:133962623-133962645 ACCGGGAGCTTTGTGGGGGGTGG - Intronic
1061976597 9:134071128-134071150 TTAAGGGGCATTGTGGGTGAAGG - Intergenic
1062366242 9:136210481-136210503 ACAGGGAGCTCTGTGGGCGGCGG + Intronic
1062506618 9:136880800-136880822 ACCTGGAGCATCCTGGGTGGAGG + Intronic
1203696021 Un_GL000214v1:97554-97576 ACAAGGTCTACTGTGGGTGGAGG + Intergenic
1203741668 Un_GL000218v1:8886-8908 ACAAGGTCTACTGTGGGTGGAGG - Intergenic
1203701854 Un_KI270742v1:3475-3497 ACAAGGTCTACTGTGGGTGGAGG - Intergenic
1203640252 Un_KI270751v1:6509-6531 ACAAGGTCTACTGTGGGTGGAGG - Intergenic
1186361041 X:8842125-8842147 ACAAGACGCATTGTGGTTTGTGG + Intergenic
1187448731 X:19378823-19378845 AGATTGAGCATTGCGGGTGGGGG - Intronic
1190252323 X:48736665-48736687 ACAAGGAGAATTTTGGAAGGTGG - Intergenic
1193063516 X:77232870-77232892 ACAATGAACTTTGTGAGTGGAGG + Intergenic
1193988265 X:88273995-88274017 ATAATGTGCATGGTGGGTGGTGG - Intergenic
1198995446 X:142568611-142568633 AGCAGAAGCATGGTGGGTGGAGG + Intergenic
1199964620 X:152809570-152809592 ACAAGGAGCATGGTGACTGAGGG + Intergenic
1200247204 X:154532533-154532555 AGAAGGAGCAGTGTGGAGGGTGG - Intronic
1201155194 Y:11126340-11126362 ACAAGGTCTACTGTGGGTGGAGG - Intergenic