ID: 1104399831

View in Genome Browser
Species Human (GRCh38)
Location 12:128466150-128466172
Sequence CTAGTTCTCCATCGCAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104399831_1104399837 13 Left 1104399831 12:128466150-128466172 CCGCTGCTGCGATGGAGAACTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104399837 12:128466186-128466208 AGGGGAGAGCACAGGAAAGAAGG 0: 1
1: 0
2: 7
3: 119
4: 1116
1104399831_1104399834 -5 Left 1104399831 12:128466150-128466172 CCGCTGCTGCGATGGAGAACTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104399834 12:128466168-128466190 ACTAGCCAGCATGTGTGAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 123
1104399831_1104399833 -6 Left 1104399831 12:128466150-128466172 CCGCTGCTGCGATGGAGAACTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104399833 12:128466167-128466189 AACTAGCCAGCATGTGTGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 123
1104399831_1104399832 -7 Left 1104399831 12:128466150-128466172 CCGCTGCTGCGATGGAGAACTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104399832 12:128466166-128466188 GAACTAGCCAGCATGTGTGAAGG 0: 1
1: 0
2: 2
3: 8
4: 107
1104399831_1104399836 5 Left 1104399831 12:128466150-128466172 CCGCTGCTGCGATGGAGAACTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104399836 12:128466178-128466200 ATGTGTGAAGGGGAGAGCACAGG 0: 1
1: 1
2: 2
3: 25
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104399831 Original CRISPR CTAGTTCTCCATCGCAGCAG CGG (reversed) Intronic
901855156 1:12039671-12039693 CTAGTTCTCCCTCGAGGCTGGGG - Intergenic
902963434 1:19980609-19980631 CTAGGTCTCCATCCCTGCAAGGG - Intergenic
914426248 1:147579732-147579754 TGAGTTCTCCATCTCAGCCGAGG - Intronic
915554512 1:156653970-156653992 CTAGCCCTGCATCTCAGCAGGGG + Intronic
1063464844 10:6236445-6236467 CTATTTCTGGAGCGCAGCAGTGG - Intergenic
1075657647 10:124172776-124172798 CAAGTCCTCCTTCGCAGAAGAGG - Intergenic
1081608174 11:44540628-44540650 CTGCTTCTCCATGACAGCAGGGG + Intergenic
1083707953 11:64529691-64529713 CTAGGCCTCCATGGCAGCTGGGG - Intergenic
1086996013 11:93356340-93356362 CTAGTTTTCCTTCACAGTAGAGG + Intronic
1088404472 11:109458040-109458062 CTATATTTCCATCCCAGCAGAGG - Intergenic
1095889264 12:47220660-47220682 CTAGTTCTGGATGGCAGAAGTGG - Intronic
1096979253 12:55719010-55719032 CTAATATTCCATTGCAGCAGTGG - Intronic
1098624798 12:72650999-72651021 CTTGTTTTCCATCTCAGCACTGG - Intronic
1098855880 12:75652874-75652896 GAAGTTCCCCATGGCAGCAGGGG + Intergenic
1104399831 12:128466150-128466172 CTAGTTCTCCATCGCAGCAGCGG - Intronic
1104491011 12:129193367-129193389 ATAATTCTCCATCGCAGAAATGG + Intronic
1118795217 14:69137349-69137371 TTAGTTCTCTATGGCAGAAGAGG - Intronic
1119594153 14:75918222-75918244 CTACTTCTCCTTAGCAACAGAGG + Intronic
1125916155 15:43489608-43489630 CTAATGCTCCATCTAAGCAGAGG + Intronic
1128412458 15:67413335-67413357 AAAGGACTCCATCGCAGCAGTGG - Intronic
1128426119 15:67543358-67543380 CTGGTTCTCCATGGCAGGAAAGG - Exonic
1136999252 16:35215078-35215100 CTTGTTCTCCATCACAGAGGTGG + Intergenic
1137001217 16:35232723-35232745 CTTGTTCTCCATCACAGAGGTGG + Intergenic
1137003703 16:35253074-35253096 CTTGTTCTCCATCACAGAGGTGG - Intergenic
1137031784 16:35531477-35531499 CTTGTTCTCCATCACAGAGGTGG + Intergenic
1143537550 17:7550174-7550196 CTAGTTCGGCCTCGCAGAAGTGG + Exonic
1143944796 17:10581266-10581288 CCAGTTCTCAGTCCCAGCAGAGG - Intergenic
1146019417 17:29264439-29264461 CTAGATCTTCAACGCAGCAGAGG - Exonic
1146317937 17:31823101-31823123 CTGTTTCTCCATACCAGCAGAGG - Intergenic
1146702860 17:34976887-34976909 CTAGTTCTATTTCACAGCAGGGG + Intronic
1148521791 17:48283813-48283835 CTAGTTCCCCAGGGCAGAAGTGG + Intronic
1151174270 17:72274266-72274288 CTAGTTCTTAATCTCAGCAGAGG - Intergenic
1152109472 17:78349739-78349761 CTAGTTCTCCCTCTCTGCTGAGG - Intergenic
1152328997 17:79659778-79659800 CTATTTCTCCATCTCAGTGGTGG - Intergenic
1155503228 18:26507325-26507347 CTGCTTCTCCATCACAGAAGTGG - Intronic
1158724206 18:59953913-59953935 CTATTTCTACATCTGAGCAGTGG - Intergenic
1159640524 18:70858633-70858655 GTATTTCTTCATAGCAGCAGGGG + Intergenic
1159909597 18:74132918-74132940 CCAGTGCCCCATCCCAGCAGCGG - Intronic
926094170 2:10070315-10070337 CAGGTTCTCCATCTCAGCACGGG - Intronic
933274224 2:80266553-80266575 CTAGCTCTCCATGGAAGAAGAGG - Intronic
935242127 2:101187982-101188004 ATAGTTCTGCATGGCTGCAGAGG - Intronic
935925266 2:108061542-108061564 GCATTTCTACATCGCAGCAGTGG - Intergenic
944342006 2:198612204-198612226 TTAGTCCTTCATCCCAGCAGAGG + Intergenic
944457111 2:199907051-199907073 ATAGTTCTGCATGGCTGCAGAGG + Intergenic
1173153671 20:40589393-40589415 CTGGTTCTCCATCCCTCCAGAGG - Intergenic
1173889082 20:46489869-46489891 CTGGTTCTCCATCTTATCAGTGG + Intergenic
1178627930 21:34233720-34233742 CTAGTTCTCACTAGGAGCAGGGG + Intergenic
1181816869 22:25445033-25445055 CTATTTCTCCCTGGAAGCAGAGG - Intergenic
1184893924 22:47396197-47396219 GCAGTTCTTCATCGCAGGAGGGG + Intergenic
1185176480 22:49330191-49330213 CTGGTTCTCCTTGGCTGCAGTGG + Intergenic
952516376 3:34108442-34108464 TTTGTTCTCCATGGTAGCAGAGG - Intergenic
954360472 3:50119969-50119991 CAGTTTCTCCATCGCAGCAGAGG - Intergenic
987217781 5:15755907-15755929 CCAGTTCTCCATAGCAGTGGAGG + Intronic
991488854 5:67164700-67164722 CCAGTTCTCCCCAGCAGCAGTGG + Exonic
992954074 5:81890009-81890031 CTAGTTCTGCATGGCTGGAGAGG - Intergenic
993106078 5:83602435-83602457 CAAGTTCCCCATCTCAGCAAAGG + Intergenic
994291737 5:98034588-98034610 CAACTTCCCCATCCCAGCAGTGG - Intergenic
995368578 5:111392202-111392224 CCAGTTCTGCATGGCTGCAGAGG + Intronic
998198240 5:140095466-140095488 CTAGTTTTCCATGACGGCAGAGG + Intergenic
1001218399 5:169877199-169877221 CTAGTTCCCCATGGCTGGAGAGG + Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1002438160 5:179246129-179246151 CTTATTCTCCAACTCAGCAGTGG + Intronic
1005092916 6:22078098-22078120 CCTGTTCTCCATGGCATCAGAGG - Intergenic
1006197235 6:32252505-32252527 CTAGTCCTCATTCTCAGCAGAGG - Intergenic
1016023468 6:139259868-139259890 TTAGTTCTCCATAGAAGCTGGGG + Intronic
1017937422 6:159018521-159018543 CTTTTTCTCCATCCCAGCATAGG - Intergenic
1020211747 7:6163257-6163279 CTAGGTTTCCTTCTCAGCAGCGG - Exonic
1026993749 7:74602718-74602740 CTCCTTCTTCATCACAGCAGAGG + Intergenic
1028808759 7:95060082-95060104 CCAGTTCTCCCACACAGCAGAGG + Intronic
1031526780 7:122831629-122831651 CTAGCTTTCCATCTCAGCACAGG + Intronic
1031580305 7:123466551-123466573 ACAGATCTCCATAGCAGCAGAGG - Intronic
1032105972 7:129030165-129030187 CTAGGTCTCTTTTGCAGCAGGGG - Intronic
1032656593 7:133937091-133937113 CCAGTTCTTCATCTCTGCAGTGG + Intronic
1035244922 7:157556000-157556022 CTAGCTCTCCATGTCAGCCGAGG + Intronic
1035301493 7:157900528-157900550 CAAGTTCTCCATGCCTGCAGGGG - Intronic
1042050354 8:64697641-64697663 CCTGTTCTCCCTGGCAGCAGTGG - Intronic
1053387997 9:37710340-37710362 CTGCTTCTCCATGGTAGCAGTGG + Intronic
1058551415 9:106119611-106119633 TTATTTCTACATAGCAGCAGGGG - Intergenic
1062039916 9:134399783-134399805 CTAGTGCCCCATCGCAGTCGGGG - Intronic
1185506781 X:637604-637626 ATAATTCTCCATCGCCGCGGGGG + Intronic
1193940198 X:87673135-87673157 CTACTTCTCCATAGCAGAATGGG - Intergenic
1195179757 X:102346174-102346196 TTACTTTTCCATTGCAGCAGAGG - Intergenic
1195675841 X:107506770-107506792 CTAGTTCGCCACCTCAGCCGCGG + Intergenic
1200805234 Y:7427096-7427118 CTATTTCTCCATAACAGCACTGG + Intergenic