ID: 1104400417

View in Genome Browser
Species Human (GRCh38)
Location 12:128471485-128471507
Sequence AGAGCTATGCCTAGGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104400417_1104400422 -10 Left 1104400417 12:128471485-128471507 CCCCTGGCCCTAGGCATAGCTCT 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1104400422 12:128471498-128471520 GCATAGCTCTGAAAAAAGACAGG 0: 1
1: 0
2: 1
3: 13
4: 191
1104400417_1104400423 5 Left 1104400417 12:128471485-128471507 CCCCTGGCCCTAGGCATAGCTCT 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1104400423 12:128471513-128471535 AAGACAGGAATATATAAGATAGG 0: 1
1: 0
2: 3
3: 38
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104400417 Original CRISPR AGAGCTATGCCTAGGGCCAG GGG (reversed) Intronic
900377141 1:2360118-2360140 GGACCTGTGCCTAGTGCCAGGGG - Intronic
900577238 1:3389409-3389431 AGAGCTATCCCTATGGCGTGGGG + Intronic
900962983 1:5937529-5937551 AGAACTGGGCCCAGGGCCAGAGG - Intronic
901506964 1:9690827-9690849 GTAGCTATGCCCAGGGCCTGGGG + Intronic
901662372 1:10806579-10806601 AGAGCCCTGGCTGGGGCCAGAGG - Intergenic
902332171 1:15736056-15736078 AGCCCTTTGCCCAGGGCCAGAGG + Intergenic
903211310 1:21820717-21820739 AGAGCCATGCCTGGGGGCATAGG + Intronic
903808625 1:26022322-26022344 AGAGCAGTGCCCAGGGGCAGGGG + Exonic
904260191 1:29283647-29283669 GGGGCGAGGCCTAGGGCCAGAGG - Intronic
905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG + Intronic
907284826 1:53372821-53372843 AGACAAATGCCTGGGGCCAGTGG - Intergenic
907724968 1:57011244-57011266 AGAGCTCTGTCTAGGGGCTGGGG + Exonic
912333827 1:108844466-108844488 AGACCTTTGCCAAGGCCCAGTGG + Intronic
914827315 1:151145530-151145552 AGAGGTGGGCCTAGGGCCAGGGG + Intronic
915299189 1:154942305-154942327 AGAGCTATCCCCAAGGCCTGTGG + Intergenic
919858788 1:201724634-201724656 AAACCTATGCCAAGGGCCACAGG + Intronic
920099437 1:203507769-203507791 CCAGCAAGGCCTAGGGCCAGAGG + Intronic
921390107 1:214607572-214607594 AGAGCTATGCCTGGTCCCTGCGG + Intronic
921452138 1:215321810-215321832 AGAACTTTGCCTTGGGCTAGTGG + Intergenic
923918067 1:238530640-238530662 ACAGAGATGCCTAGGTCCAGAGG + Intergenic
924832037 1:247606376-247606398 ACAGCTATGCCCAGGACCAAGGG + Exonic
1064281505 10:13955523-13955545 AAAGAAATGCCCAGGGCCAGAGG - Intronic
1067802527 10:49368931-49368953 AGGGCTAAGCCTAAGGACAGTGG - Intronic
1068454729 10:57239299-57239321 AGAGATATGGGTAGGGCCAGTGG + Intergenic
1073314334 10:102567857-102567879 GGAGCTAGGCCTGGGGCTAGGGG - Intronic
1074456638 10:113601256-113601278 AAAGCTCTGGGTAGGGCCAGAGG - Intronic
1074741357 10:116487278-116487300 TGTACTATGCCTAGGGCTAGGGG + Intergenic
1075417789 10:122278131-122278153 GGAGCTAGGCCTAGGAACAGAGG + Intronic
1080045235 11:27801052-27801074 AGGGCTATGTCTTGGGCCATTGG - Intergenic
1083459393 11:62800552-62800574 AGAGCTAAGCGTAGGGACTGGGG - Intronic
1085521207 11:77139885-77139907 AGAACTTTCCCTAGGGCCACAGG + Intronic
1086401658 11:86465700-86465722 AGAACAATGCCTGGTGCCAGAGG - Intronic
1086650812 11:89287565-89287587 AGAGATATGCCTAACTCCAGGGG + Intronic
1088544440 11:110945680-110945702 AGAACAGTGCCTAGGGACAGAGG - Intergenic
1088971276 11:114776461-114776483 AGAGCACTGCCTCGAGCCAGAGG - Intergenic
1090863641 11:130676145-130676167 AGTTCTATGCCTTGGGCCAAGGG - Intronic
1091873010 12:3910817-3910839 AGACCTTTGCCTGGGGCCTGGGG + Intergenic
1096332465 12:50726228-50726250 AGAGGTATGGCTGGAGCCAGAGG + Intronic
1096605973 12:52766812-52766834 AGAGCTAGGCCAAGGGAAAGTGG + Intergenic
1096936446 12:55284910-55284932 AGAGCTATTTCTAGGCACAGAGG - Intergenic
1097041987 12:56161320-56161342 AGGGGTACGCCAAGGGCCAGGGG - Intronic
1103711207 12:122913971-122913993 AGAGTTATGCACAGGCCCAGAGG + Intergenic
1104400417 12:128471485-128471507 AGAGCTATGCCTAGGGCCAGGGG - Intronic
1109689325 13:65865271-65865293 AAAGCTATGCATGGGTCCAGTGG + Intergenic
1111474116 13:88724347-88724369 AGAGCTTGGGCTGGGGCCAGAGG + Intergenic
1113897823 13:113776942-113776964 AGAGCTTCGCCTAGGGTCACAGG + Intronic
1114401150 14:22411929-22411951 GGAGCTATGCATAAGGCCAATGG + Intergenic
1118500977 14:66362336-66362358 AAAGCTCTGCCCAGGGCCACAGG + Intergenic
1119938026 14:78610992-78611014 AGAGGAAGGCCAAGGGCCAGGGG - Intronic
1121421846 14:93821473-93821495 ACAGATCTGCCTAGGGGCAGGGG + Intergenic
1126979917 15:54228892-54228914 TGTGCTATGCTTAGAGCCAGTGG - Intronic
1127911507 15:63419889-63419911 AGTGCTATGCCATGGGCCACGGG + Intergenic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1128760829 15:70215068-70215090 AGAGCTAGGCCCAAGCCCAGGGG + Intergenic
1129156508 15:73721617-73721639 AGAGGCCTGGCTAGGGCCAGGGG - Intergenic
1129945406 15:79535204-79535226 GGTGCTATGACTATGGCCAGGGG + Intergenic
1130270508 15:82443934-82443956 AGAGCCATCTGTAGGGCCAGAGG + Intergenic
1130462852 15:84171253-84171275 AGAGCCATCTGTAGGGCCAGAGG + Intergenic
1130489822 15:84423534-84423556 AGAGCCATCTGTAGGGCCAGAGG - Intergenic
1130501413 15:84502284-84502306 AGAGCCATCTGTAGGGCCAGAGG - Intergenic
1130508928 15:84572407-84572429 AGAGCCATCTGTAGGGCCAGAGG - Intergenic
1132907454 16:2290175-2290197 AGGGCTCTGCCAAGGGCCAGAGG - Intronic
1133967433 16:10541644-10541666 AGGGCTGTTCCCAGGGCCAGAGG + Intronic
1136142649 16:28297420-28297442 AGAGCTGTGCCCAGTGACAGGGG - Intronic
1141638814 16:85329518-85329540 AGACCCAGGCCTGGGGCCAGCGG - Intergenic
1143907419 17:10220303-10220325 AGAGCAGTGCCTAGGTCCAGAGG + Intergenic
1146929700 17:36768482-36768504 AGAGCCCTGCCTGGGGGCAGGGG + Intergenic
1151575174 17:74949562-74949584 AGGGCACTGCCTAGAGCCAGAGG + Exonic
1153671660 18:7418020-7418042 ATACCTATGTCTAGGGCAAGAGG - Intergenic
1155588916 18:27402066-27402088 ACAGCTATGCCAAGGGCATGAGG - Intergenic
1158271933 18:55726036-55726058 AGAGCAGTGCCTAGAGCCAGAGG + Intergenic
1158398989 18:57104062-57104084 GGGGCTGTGCCTAGGGCAAGGGG - Intergenic
1162079955 19:8211917-8211939 AGAGTCATGCCTGGGGTCAGGGG + Intronic
1166499710 19:43331527-43331549 GGAGCACTTCCTAGGGCCAGGGG + Intergenic
1167380541 19:49135690-49135712 AGAGACAGACCTAGGGCCAGGGG - Intronic
1167520589 19:49952174-49952196 AGAACTAGGCCTTGGGCAAGAGG - Intronic
925970279 2:9101710-9101732 AGAGAAATGCCAAGGGCAAGGGG + Intergenic
926549820 2:14288116-14288138 AGAGCTCTCCCTAGTGCCTGGGG - Intergenic
927037202 2:19190373-19190395 AGAGCCATGCCAGGGGCCGGAGG - Intergenic
927845123 2:26467410-26467432 AGAGCTCTGGCTCTGGCCAGGGG - Exonic
932001251 2:67887027-67887049 AGAGATATGCATAGGGTGAGTGG - Intergenic
935351490 2:102154945-102154967 AGAGCCATGCCCAGGGCAGGAGG - Intronic
936569766 2:113603405-113603427 AGGGCTAGGGCTAGGGCTAGGGG - Intergenic
936894113 2:117407370-117407392 AGAGATGTGCTTAGGGCTAGAGG - Intergenic
937104195 2:119294849-119294871 AGGGTTAGGCCTGGGGCCAGAGG + Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
942486511 2:176445549-176445571 AGAGTTATGCATAGAGCCATGGG - Intergenic
943101646 2:183494028-183494050 AGAGCAATTCCTAGGGTCACAGG - Intergenic
943734464 2:191339267-191339289 AGAGCTATACCTTGGACTAGAGG + Intronic
946337945 2:219050751-219050773 AGAACTATGCCTAAGTCCACAGG - Intergenic
948699041 2:239749155-239749177 AGGACTATGCATAGGGCCTGGGG + Intergenic
948776252 2:240290416-240290438 TGAGCCAGGCCGAGGGCCAGTGG + Intergenic
1173525492 20:43729478-43729500 GGAGCTATCCCTAGGGTGAGTGG - Intergenic
1174447146 20:50597855-50597877 AGTGCCACGCCTTGGGCCAGCGG - Intronic
1175243781 20:57568856-57568878 AGAGCTCTGCCGCTGGCCAGTGG + Intergenic
1180021788 21:45133241-45133263 TGAGCTCTGCCAAGAGCCAGTGG - Intronic
1181440746 22:22934118-22934140 AGAGCTCTGCAGAGGGGCAGGGG + Intergenic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1184300012 22:43553099-43553121 AGAGCTGTGAGTAGAGCCAGGGG + Intronic
1185419700 22:50728591-50728613 AAAGCTAAGCCTTGGGGCAGGGG + Intergenic
949907162 3:8867299-8867321 AGAACTATAACTAGAGCCAGTGG - Intronic
953030194 3:39174929-39174951 AGAGCTGTGCCTGAGGCCAAGGG - Intergenic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
956923088 3:73951551-73951573 AGAGCAATGCATAGTGCAAGTGG + Intergenic
959743909 3:109753949-109753971 AGAACTATCCCTAGGGGTAGGGG + Intergenic
964411518 3:156402983-156403005 AGAGCTCGGCATAGGGTCAGGGG - Intronic
964553971 3:157915267-157915289 AGAGCTACACCTAGGGATAGTGG + Intergenic
965387696 3:168064169-168064191 AGAGATATGCCTATGGCCTGTGG - Intronic
966366027 3:179188046-179188068 AGAGTTCTCCCTAGGGTCAGTGG + Intronic
967681281 3:192366882-192366904 AGAGATAGACCTAGGGCCAATGG + Intronic
968689480 4:1983361-1983383 TGAACTATGCCACGGGCCAGTGG - Exonic
970364651 4:15346223-15346245 AGCACTTTGCCTAGGGTCAGAGG + Intronic
975365742 4:73525376-73525398 AGAGCTATGCCCAGGGTTATTGG + Intergenic
975709070 4:77141023-77141045 AGAGCTAAGCACAGGGCCATGGG - Intergenic
976055986 4:81067616-81067638 AGAGTTAAGCCTAGGGGAAGTGG - Intergenic
976814627 4:89133223-89133245 AGAGCTGGGCCTAGGGCAAGGGG + Intergenic
981849507 4:149212930-149212952 AGGGCAATGCCTAACGCCAGAGG + Intergenic
982869963 4:160566573-160566595 AGAGCTGGGCCCAGGGCCATTGG + Intergenic
984141682 4:176011959-176011981 AGGCCTATGACTAGGGCCAGAGG + Intergenic
985619084 5:944275-944297 AGAGAACTGCCTGGGGCCAGTGG + Intergenic
986606702 5:9529911-9529933 GGAACTATGCCTAGGGCTACAGG - Intronic
990727506 5:58773186-58773208 AGTTATAAGCCTAGGGCCAGGGG + Intronic
997248470 5:132370713-132370735 AGAGCCAGGACTTGGGCCAGGGG + Intronic
997668981 5:135654995-135655017 AGAGCTGTGCCTTGGGGCAGAGG + Intergenic
999623818 5:153499320-153499342 AGATCTATGAATATGGCCAGGGG + Intronic
1000365808 5:160489883-160489905 AGAGCTATGGCCAGGCACAGTGG - Intergenic
1002426750 5:179181186-179181208 AGAGCCAGTCCTAGGGCCTGTGG - Intronic
1005864155 6:29926184-29926206 AGAGCCACGCCTGGGGCCATAGG - Intergenic
1008211037 6:48726417-48726439 AGAGCTCTGTCTAGGCTCAGAGG + Intergenic
1013691338 6:112648503-112648525 TGAGCAAAGCTTAGGGCCAGAGG + Intergenic
1013836499 6:114342003-114342025 AGAGGTTTGCTTAGGACCAGAGG - Intronic
1016813510 6:148282909-148282931 TGAGCTATGCTTAGAACCAGTGG - Intronic
1018065631 6:160123424-160123446 AGAGCAATGCTCAGGCCCAGAGG - Intronic
1019475623 7:1242766-1242788 AGAGCTCGGCCTGGGGCCACGGG + Intergenic
1019492350 7:1321376-1321398 ACAGCTTTGCCTAGGGCTGGTGG + Intergenic
1020102040 7:5399298-5399320 TGAGCTCAGCCTAGGGCGAGAGG - Intronic
1020976008 7:15007513-15007535 AGACCAATGCCAAGGTCCAGAGG + Intergenic
1021738690 7:23663800-23663822 AGGGCTGTGCCTTGGGCCATTGG + Intergenic
1021765466 7:23943996-23944018 AGCACTCTGCCTAGGGCCCGAGG + Intergenic
1025721882 7:64024597-64024619 ATAGATAGGCCTAGGGCCATGGG + Intergenic
1025745467 7:64238932-64238954 ATAGATAGGCCTAGGGCAAGGGG + Intronic
1026895156 7:74006158-74006180 AGATCTATGCCTCGGGCAATGGG + Intergenic
1026962261 7:74416520-74416542 AGGGCTCTGCCCAGGGCCACAGG - Intergenic
1028226230 7:88255446-88255468 AGAGCCCTGCCTCGAGCCAGTGG - Intergenic
1031408951 7:121419895-121419917 AGAGCCTTGCCTAGGGTCACTGG - Intergenic
1034105694 7:148487920-148487942 AGGGCAATGCCTATGGCGAGAGG + Intergenic
1034321220 7:150184485-150184507 GGAGAGATGCATAGGGCCAGAGG + Intergenic
1035085172 7:156252132-156252154 AGTGCTGTGCCGAGGGCCATGGG - Intergenic
1039533218 8:38283431-38283453 AGAGCTATGAGAAGGGCTAGTGG - Intronic
1042178828 8:66064415-66064437 AGAGCTTTGACTAGAACCAGGGG + Intronic
1043419500 8:80084263-80084285 AGGCCCATGCCTGGGGCCAGGGG - Intronic
1047170766 8:122490303-122490325 AGAACTGTGCAGAGGGCCAGAGG + Intergenic
1050310679 9:4350156-4350178 AGAGCTATCACAAGGCCCAGTGG + Intergenic
1051203535 9:14659191-14659213 GGAGCTAAGCCTCTGGCCAGAGG + Intronic
1057278161 9:93687174-93687196 AGAGCTAAGACTGAGGCCAGAGG - Intergenic
1058685871 9:107479030-107479052 AGAGCTATGTGCTGGGCCAGAGG + Intergenic
1059329788 9:113527644-113527666 AAAGCTATCCCTAGGGCCAAGGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060795152 9:126508150-126508172 AGAGCAATGCCCAGGGCCCCAGG + Intergenic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1195003257 X:100662625-100662647 AGAGCTAAGGCTTGGGCCTGAGG + Intronic
1196093812 X:111776770-111776792 AGAACCATGCCAAGGTCCAGTGG - Exonic
1200785352 Y:7255957-7255979 AGGGCTATGTCAAGGGGCAGTGG - Intergenic