ID: 1104400677

View in Genome Browser
Species Human (GRCh38)
Location 12:128473503-128473525
Sequence GTGAAGATGAAGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 4, 1: 4, 2: 21, 3: 91, 4: 726}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104400677 Original CRISPR GTGAAGATGAAGATGGAGGC TGG (reversed) Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900505269 1:3027256-3027278 GTGGAGGAGATGATGGAGGCAGG - Intergenic
900537564 1:3186385-3186407 GCCAAGAGGAAGATGGAAGCCGG + Exonic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
900894788 1:5475520-5475542 GTGAGGGTGGAGATGGAGACCGG + Intergenic
901039636 1:6356187-6356209 GTGAAGATGAAGGCAGAGACGGG + Intronic
901228030 1:7625704-7625726 GTGGCGATGAAGATGGGGTCTGG + Intronic
901509191 1:9707277-9707299 TTGTTGATGAAGATGAAGGCTGG - Intronic
902233438 1:15042872-15042894 GTGAATGGGAAGATGGTGGCTGG + Intronic
902411008 1:16211568-16211590 GGGGAGATGAAGCTGGAGGCAGG + Intronic
902729148 1:18357278-18357300 ATGGAGATGAAGATGGAGTGGGG + Intronic
903321760 1:22547580-22547602 GGGAAGAGACAGATGGAGGCAGG - Intergenic
903644620 1:24887115-24887137 GTGAAGATGAAGGCAGAGACTGG - Intergenic
903690192 1:25167802-25167824 ATGAGGAGGTAGATGGAGGCAGG + Intergenic
904778797 1:32929208-32929230 GTGAAGATGAAGGCAGAGACTGG - Intergenic
904869682 1:33608666-33608688 GTGAAGATGAAGCCAGAGGTCGG + Intronic
905150973 1:35927399-35927421 GTGAGGATAAACATGGAGGATGG - Exonic
905174197 1:36125796-36125818 GTGTGGAGGAAGATAGAGGCAGG + Intergenic
905256265 1:36687475-36687497 GTGAAGAGGAAGGTGGAGATTGG + Intergenic
905345160 1:37306300-37306322 GTGAAGAAGCAGATGGCAGCCGG - Intergenic
905405804 1:37731646-37731668 GTGAACAGGAACAGGGAGGCAGG + Intronic
905881829 1:41468853-41468875 GTGAGGATGGAGCTGGGGGCTGG + Intergenic
905951462 1:41954995-41955017 GAGAAGATCAAAATTGAGGCTGG + Intronic
906372166 1:45263353-45263375 GTCAAGATGAAGACAGAGGCAGG - Intronic
907464953 1:54628761-54628783 ATTAAGAGGAAGATAGAGGCTGG + Intronic
907567093 1:55445410-55445432 GTGAAGATGGAGGCAGAGGCTGG + Intergenic
907850645 1:58251673-58251695 GAGAGGTTGAAGAGGGAGGCTGG + Intronic
908326903 1:63031918-63031940 GTGAAGATGAAGGCAGAGACCGG + Intergenic
908510774 1:64848468-64848490 GTGAAGATGAAGGTGGAGCCTGG + Intronic
908581689 1:65523966-65523988 GTGAAGATGAAGGCAGAGACTGG + Intronic
908819184 1:68065932-68065954 GAGGAGATGAAGATGGGGGTGGG - Intergenic
909232208 1:73105302-73105324 GAGAAGCTGAAGCTGAAGGCAGG + Intergenic
909931213 1:81502353-81502375 GTGATGATGCAGATGGAGGCCGG + Intronic
910006772 1:82406867-82406889 GTGAAGATGGAGATGAAGATAGG + Intergenic
910650116 1:89557578-89557600 ATGCAGATGATGGTGGAGGCAGG + Intronic
911197068 1:95005337-95005359 GTGAACATGAAAAGGGAGGCAGG + Intronic
911729873 1:101281647-101281669 GTGAGGCTGAGGATGGAGGTAGG + Intergenic
912417644 1:109520983-109521005 GTGAAGATTAGGAAGGGGGCAGG + Intergenic
912491413 1:110064770-110064792 GGAAAGAGGAAGATGCAGGCTGG + Exonic
912963073 1:114213332-114213354 AAGAAAATGAAGATGGAGACAGG + Intergenic
913131574 1:115842488-115842510 GTTAAAGTGAAGATGGAAGCCGG + Exonic
914248378 1:145902137-145902159 GGGAAGGTGAGCATGGAGGCTGG + Intronic
915276087 1:154789202-154789224 GTGATGGTGAAGCAGGAGGCTGG - Intronic
915717806 1:157961005-157961027 ATGAAGATGATGTTGGAGCCTGG + Intergenic
915762714 1:158331088-158331110 GTGAAGATAAAGAGAGAAGCAGG + Intronic
917450107 1:175140982-175141004 GCTAAAATGAAGATAGAGGCTGG - Intronic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
917635406 1:176930943-176930965 GTGAAGATTAAAATGGAGGAGGG + Intronic
917787466 1:178474076-178474098 GTGAAGATGAAGATGGTATGTGG - Intronic
918076838 1:181177003-181177025 GTGAATATGGAGGTGGAGGTGGG + Intergenic
919718528 1:200806871-200806893 ATGAGGAAGAAGTTGGAGGCAGG + Intronic
919839425 1:201598296-201598318 TTGAAGATAAAGAATGAGGCAGG + Intergenic
919920281 1:202163186-202163208 GTGAGGAGGAAGAGGGAGGCTGG - Intergenic
919978039 1:202625631-202625653 GTGGAGATGGGGCTGGAGGCAGG - Intronic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920437479 1:205956769-205956791 GTTAAGATGAAGATGGGGGCTGG - Intergenic
920719681 1:208375438-208375460 GTGAAGATGGAGGTAGAGACTGG + Intergenic
921189103 1:212694222-212694244 GTCAAAATGAAGATGGCAGCAGG - Intronic
921311905 1:213853004-213853026 GTGAAGATGAAGATACAGATTGG - Intergenic
922519000 1:226230106-226230128 GTGATAATGAAGATGGAGAGAGG + Intergenic
922819556 1:228474681-228474703 GTTAAGAGGCAGATGGAGGGAGG + Intergenic
922858598 1:228796075-228796097 GTGAAGAAGAGTATGGAGGATGG - Intergenic
922926741 1:229353678-229353700 GTGGAGATAAAAATGGTGGCTGG - Intergenic
922929718 1:229379617-229379639 TTGAAGATGAATTTGGTGGCTGG + Intergenic
923061700 1:230481435-230481457 GCGAGGATGACGATGGAGGGAGG + Intergenic
923155792 1:231278363-231278385 GTGAAATTGAAGACAGAGGCAGG + Intergenic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
923774802 1:236968679-236968701 GTGAATATGAAGAAAGAGACCGG - Intergenic
924003693 1:239583033-239583055 GTGACAAGGAAGATGGTGGCTGG - Intronic
924227483 1:241933779-241933801 GTTAAGATTAAGAATGAGGCTGG - Intergenic
924319106 1:242829422-242829444 GGGAAGAGCAAGATGGAGACTGG + Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063447693 10:6130002-6130024 GGGAAGAAGAAGCTGGAGACAGG - Intergenic
1064333909 10:14420854-14420876 GTCAAGATCAAGATGAAGACAGG + Intronic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1064923899 10:20549369-20549391 GTGAAGATGAAGGTAGAGATTGG + Intergenic
1065217848 10:23467469-23467491 GTGAAGTTGGAGATGTGGGCAGG + Intergenic
1065330254 10:24588941-24588963 CTGGAGATGAAGATGGGTGCAGG + Intronic
1066589719 10:36981336-36981358 GTGAAGATGGAGCTGGAGATGGG + Intergenic
1067014612 10:42748059-42748081 TGGAAGATGGAGATGGAGGTGGG + Intergenic
1067290214 10:44934652-44934674 GTGATGATGAGCATGGAGCCTGG - Exonic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1068219100 10:54020605-54020627 GGGGAGAGAAAGATGGAGGCAGG + Intronic
1068652987 10:59543000-59543022 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1069048227 10:63765110-63765132 GTGAAGATGAGGTAGGAGGTGGG - Intergenic
1069172292 10:65247424-65247446 GTGGAGATGAAGATGAAAGGGGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069711733 10:70493800-70493822 GTGCAGGTGATGCTGGAGGCGGG - Intronic
1069990479 10:72312395-72312417 GTGAAGATAAAGGCAGAGGCTGG - Intergenic
1070421725 10:76244002-76244024 ATGAAGATGGAGGTAGAGGCTGG + Intronic
1070471201 10:76781404-76781426 GAAAAGAAGAAGCTGGAGGCCGG - Intergenic
1070475482 10:76825083-76825105 GTCAAGATGAAGATCAAGGCAGG - Intergenic
1070571306 10:77640884-77640906 GTGAGGATGAAAAAGAAGGCTGG + Intergenic
1071016331 10:81001257-81001279 GTGAAGATGAGGATGGGGGTGGG + Intergenic
1071286425 10:84151181-84151203 GTGAAGATGGAGACAGAGACTGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072308099 10:94127623-94127645 GTGATGATGAGGATTGTGGCAGG - Intronic
1072732131 10:97853335-97853357 ATGAGGATGAAGATGGCGCCAGG + Intronic
1073643409 10:105275683-105275705 GTGAAGATGGAGGTGGAGACTGG - Intergenic
1073771058 10:106736404-106736426 GGGAACATGAAGAGGAAGGCAGG - Intronic
1075074608 10:119342541-119342563 GTGAGGATGAAGAGGAAGACGGG - Intronic
1075838353 10:125475419-125475441 GAGAAGATGAGGAGAGAGGCTGG + Intergenic
1076046286 10:127296719-127296741 GGGAAGGGGAAGATAGAGGCTGG + Intronic
1076129824 10:128005935-128005957 ATGAAGATGGAGGTGGAAGCTGG - Intronic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1076310416 10:129502272-129502294 GTGTAGATGAAGAAGCAGACAGG - Intronic
1076433591 10:130424498-130424520 GTGAGGATGGAGACAGAGGCTGG + Intergenic
1076557383 10:131336084-131336106 TTCAAGATGAAGATGCAAGCAGG - Intergenic
1076996888 11:301789-301811 GTTAAGATCAAGATTGTGGCCGG + Intergenic
1077159839 11:1107706-1107728 GTGAAGAGCAAGATGGTGCCTGG + Intergenic
1077167599 11:1150743-1150765 GGGAAGATGAAGATGGAAGCAGG + Intergenic
1077236732 11:1485520-1485542 ATGAAGAGAAAGATGGAGCCGGG + Intronic
1077262802 11:1631993-1632015 GTGAAGATGAAGGTAGAGGTTGG + Intergenic
1077417009 11:2428761-2428783 GTGATGATGATGATGGTGGTGGG + Intergenic
1077672231 11:4167111-4167133 GGGAAGATGCAGGTGGAGACTGG - Intergenic
1077964262 11:7110960-7110982 GCGAAGATGACTATGGAGCCAGG + Intergenic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1078179435 11:8998582-8998604 GTGATGATAAGGATGGAGACTGG - Intronic
1078822506 11:14895925-14895947 GTGATGATGATGATGGTGGTGGG + Intergenic
1078925808 11:15873923-15873945 GTGAAGATGGAGACAGAGGTTGG - Intergenic
1079518332 11:21294188-21294210 GTGAAGCTAAAGATGTAGGAGGG - Intronic
1079941704 11:26688759-26688781 GTTTAGATGAAGATGGATCCGGG + Intronic
1080025591 11:27610812-27610834 GGGAAGAGGAAAATGAAGGCTGG + Intergenic
1081105197 11:39058512-39058534 GTGCAGATTCAGATGGAGGGAGG - Intergenic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1083307116 11:61766949-61766971 GGGAAGCTGAAGTTGGAGCCAGG - Intronic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1083724504 11:64621240-64621262 GGGAAGCCCAAGATGGAGGCTGG - Intronic
1084035913 11:66510320-66510342 GTAACCATGAAGATGGAGACAGG + Intronic
1084048327 11:66583898-66583920 TTTAAAATGGAGATGGAGGCCGG - Intergenic
1084703962 11:70805082-70805104 GTGAAGATGAACCTAGAGCCTGG - Intronic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1085415370 11:76315913-76315935 ATAAAGATGAAGCTGCAGGCTGG + Intergenic
1085752111 11:79170596-79170618 GTGAAGATGAAGGCAGAGACTGG + Intronic
1085841701 11:80018704-80018726 GTGAAGATGAAGGCAGAGACTGG - Intergenic
1085931520 11:81089061-81089083 GAGAAAATGAAGATGGAGTGAGG - Intergenic
1086184275 11:83994919-83994941 GTGAAGATGAAGACTGAGATCGG - Intronic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1086922868 11:92606982-92607004 GAGAAGATGAAGATGCAGGGAGG - Intronic
1087615538 11:100482565-100482587 GTGAAGATGAAGGCAGAGACGGG - Intergenic
1089040449 11:115443818-115443840 GGGAACATGAAGATGAAGTCCGG + Intronic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089772788 11:120815431-120815453 CTGATGATGGAGCTGGAGGCTGG - Exonic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1091163584 11:133449642-133449664 GTGAAGATGAAGATAGAGACTGG - Intronic
1091396688 12:157577-157599 GCGAGGATGAAGATGGTGTCGGG - Exonic
1091461822 12:648860-648882 GTGAACAAAAAGCTGGAGGCAGG - Intronic
1091531316 12:1358791-1358813 GTGGGGATGAAGTTGGAGGAGGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1092764654 12:11841784-11841806 GTTAAGAAGGAGATGTAGGCCGG + Intronic
1093518141 12:20015614-20015636 TTGAAGAGGATCATGGAGGCAGG + Intergenic
1093627857 12:21371324-21371346 GTGAATATGAGGTAGGAGGCAGG - Intronic
1094129425 12:27059477-27059499 GTAAAGAGGTAGATGTAGGCTGG - Intronic
1094271676 12:28624035-28624057 GTGATGATGGAGGTGGAGGTTGG + Intergenic
1094303771 12:28995220-28995242 ATGAAGATGAAGTTGGAGTGAGG - Intergenic
1095526261 12:43129481-43129503 GTGAAAATGAAGAGGGAAGCAGG + Intergenic
1095614518 12:44172405-44172427 ATGTGAATGAAGATGGAGGCAGG - Intronic
1095874901 12:47069388-47069410 GAGGAGATGAAGATGTAGCCAGG + Intergenic
1096491173 12:52013965-52013987 GGGAAGAGGAGGGTGGAGGCTGG - Intronic
1096652543 12:53068970-53068992 GTCAAAATGAAGACAGAGGCAGG + Intronic
1096705697 12:53420565-53420587 GTTAAGATGGTGATAGAGGCTGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097963884 12:65558609-65558631 GTGCAGATGAAGATGATGGCAGG + Intergenic
1099140965 12:78974944-78974966 AGGATGATGAAGCTGGAGGCGGG - Intronic
1099652619 12:85447761-85447783 GAGATGATGAAGATGTAGGTGGG + Intergenic
1100190106 12:92181158-92181180 ATGAAGATGAAAATGGAGATTGG + Intergenic
1101408899 12:104453241-104453263 GACAAGATGAAGAGGGAGGAAGG - Intergenic
1102022598 12:109694581-109694603 GTAAGAATGGAGATGGAGGCCGG + Intergenic
1102188632 12:110969040-110969062 GTGAAGAAGAAGATGGAGATCGG + Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102999933 12:117377563-117377585 GGGAAGTAGAAGATGGTGGCAGG + Intronic
1103238625 12:119395889-119395911 GTGAAGATGGAAGTGGAGACTGG - Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1104400634 12:128473095-128473117 GTGAAGATGAAGACAGAGTCTGG - Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400638 12:128473143-128473165 GTGAAGATGAAGATAGTGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400643 12:128473191-128473213 GTGAAGATGAAGATAGTGGCTGG - Intronic
1104400645 12:128473215-128473237 GTAAGGACAAAGATGGAGGCTGG - Intronic
1104400649 12:128473239-128473261 GTGAGGATGAAGATAGACGCTGG - Intronic
1104400651 12:128473263-128473285 GAGAAGATGAAGATAGGGGTTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400658 12:128473311-128473333 CTGAAGATGAAGATAGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400663 12:128473359-128473381 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400667 12:128473407-128473429 GCAAAGATGAAGATGGAGGCTGG - Intronic
1104400670 12:128473431-128473453 GTGAGGATAAAGATAGAGGCTGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104400675 12:128473479-128473501 GTAAGGATGAAGATAGAAGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400683 12:128473545-128473567 GTAAGGATGAAGATGGATGCTGG - Intronic
1104400686 12:128473569-128473591 GTGAAGATGAAAATAGAGGCTGG - Intronic
1104400688 12:128473593-128473615 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1104400692 12:128473641-128473663 GTGAGAATTAAAATGGAGGCTGG - Intronic
1104400695 12:128473665-128473687 GTGAGGATGAAGATAGAAGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400700 12:128473713-128473735 GTGAAGACGAAAACGGAGGCTGG - Intronic
1104555672 12:129797813-129797835 GTGTAAATGAAGCTGGAGACAGG + Intronic
1104715793 12:131015402-131015424 ATGGAGATGGAGATGGAGACGGG + Intronic
1104792138 12:131489996-131490018 GTGAGGATGCAGTTGGAGGAAGG + Intergenic
1104894813 12:132158927-132158949 GTGAAGAGGAGGGCGGAGGCCGG + Intergenic
1105210762 13:18255509-18255531 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1105287220 13:19014227-19014249 GTGAGGATGGAGAGAGAGGCAGG - Intergenic
1105664482 13:22537300-22537322 GTGAAGAGGAGGATAGAGGGAGG + Intergenic
1105698519 13:22915476-22915498 GGGAGGAGGAAGATGGCGGCGGG + Intergenic
1106396823 13:29388267-29388289 GGGAAAATAAAGATGGAGTCGGG + Intronic
1106560944 13:30845746-30845768 GGGCAGAGGAAGAGGGAGGCAGG + Intergenic
1106846480 13:33743023-33743045 GGGAAGAGGAAAAGGGAGGCAGG + Intergenic
1106929467 13:34648251-34648273 GAGAAGAAGAAGATGGGGGAGGG + Intergenic
1107252791 13:38385413-38385435 GTGAAGATTAAACTGTAGGCAGG + Intergenic
1107408655 13:40138668-40138690 GGGAAGAACAAGAGGGAGGCAGG + Intergenic
1107513972 13:41111122-41111144 GTGAGGATGAAGGCTGAGGCAGG + Intergenic
1108271884 13:48769910-48769932 GTGAAGAACAAGATGGAAACAGG - Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1108871680 13:54994558-54994580 GTGAAGAAGTAGATGCAGCCAGG + Intergenic
1109233095 13:59782943-59782965 GTGAAGGTGAAGAGAGAGCCGGG + Intronic
1109435640 13:62296772-62296794 GTGATGATGATGGTGGTGGCAGG + Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1111582196 13:90236744-90236766 GGGATGATGAAGATGATGGCTGG + Intergenic
1111736372 13:92144921-92144943 GTGATGATGAAGATGGTTGCGGG + Exonic
1112131256 13:96526180-96526202 GGGAAGATGAAGATGAAGGTGGG + Intronic
1112341636 13:98557433-98557455 GTGATGATGGTGATGGAGGGAGG - Intronic
1112391080 13:98985052-98985074 GTGAAGAAGACTATGGGGGCAGG + Intronic
1112601507 13:100859907-100859929 GGGAAGATGAGGATGGCGGGGGG + Intergenic
1112705562 13:102065124-102065146 ATGATGATGAATGTGGAGGCTGG - Intronic
1113401100 13:109994131-109994153 CTGAAGATGATGAAGGAGCCAGG + Intergenic
1113842989 13:113371010-113371032 TTGGAGATGGAGATGGAGTCTGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114552622 14:23542105-23542127 GTGAAGAGGAAGATGAAGCTAGG + Intronic
1115408469 14:33046294-33046316 GTGAAGCTGCAGAGGTAGGCAGG + Intronic
1115917250 14:38329708-38329730 GTGCTTATGAGGATGGAGGCTGG + Intergenic
1117611101 14:57484332-57484354 GTGAAGATGAAGAGAGAGGTTGG + Intronic
1117687938 14:58274587-58274609 ACTAAGATGAACATGGAGGCTGG + Intronic
1118130852 14:62961724-62961746 GTGCAGATGGAGATGGATACAGG + Intronic
1118130893 14:62962092-62962114 GTGCAGATGGAGATGGATACAGG + Intronic
1118381585 14:65221996-65222018 TAAAAGATCAAGATGGAGGCTGG + Intergenic
1118489972 14:66249394-66249416 GTGGAGATGAATATGCAGTCAGG - Intergenic
1118817729 14:69324723-69324745 GTGATGATGACGCTGGTGGCTGG - Exonic
1118989029 14:70781378-70781400 GGGAGGCTGCAGATGGAGGCAGG - Intronic
1119727549 14:76930973-76930995 GTGAAGATGGAGGCGGAGGTGGG - Intergenic
1120634305 14:86931998-86932020 CTAAAAATGAAGATGCAGGCCGG - Intergenic
1121304824 14:92899529-92899551 GGGAAGAGAAAGATGGAGCCGGG + Intergenic
1121441970 14:93955203-93955225 GAGAAGGTGAGGCTGGAGGCAGG + Intronic
1121685103 14:95829951-95829973 GTGAAGAGGAAGGTGGAGATTGG + Intergenic
1121701889 14:95961041-95961063 GTAAAGAAAGAGATGGAGGCTGG + Intergenic
1121798276 14:96753584-96753606 GTGAAGATGGAGGTAGAGGTGGG - Intergenic
1122856114 14:104561028-104561050 GGGAAGCTGATGATGGAGGAGGG - Intronic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122915957 14:104859101-104859123 TGGAAGATGGAGATGGAGGGTGG - Intergenic
1123000977 14:105293971-105293993 TTCAAGATGAAGCTGGAGGAAGG + Intronic
1123713598 15:23010001-23010023 GTCAATATGAGGATAGAGGCAGG + Exonic
1124411555 15:29441736-29441758 GTGATGGTGTAGATGGAGTCAGG - Intronic
1124493652 15:30173567-30173589 GTGGAGATGGGGCTGGAGGCAGG - Intergenic
1124749915 15:32365082-32365104 GTGGAGATGGGGCTGGAGGCAGG + Intergenic
1125310963 15:38377789-38377811 GAGAAGAGGAAGAGGAAGGCTGG + Intergenic
1125458572 15:39886429-39886451 GTGAAAATCAAGATGGGGGTGGG - Intronic
1125580781 15:40783928-40783950 GTGAAGAAGAAGGAGCAGGCTGG + Intronic
1125935852 15:43635009-43635031 GTGAAGACGGAGATAGAGGTTGG - Intronic
1126529082 15:49691579-49691601 GTAGAGATGAAGCTGAAGGCAGG + Intergenic
1126648214 15:50896155-50896177 GGGGATATGAAGATGAAGGCAGG - Intergenic
1126868513 15:52962458-52962480 GGGAAGATGAGGCAGGAGGCTGG - Intergenic
1126896064 15:53258335-53258357 AGGAGGATGAAGTTGGAGGCAGG + Intergenic
1127130322 15:55855557-55855579 GTTAGGAAGAGGATGGAGGCAGG + Intronic
1127485856 15:59417025-59417047 CTGAAGAGGATGATGGGGGCTGG + Intronic
1127503179 15:59573603-59573625 CTGGAGATGTAGATGGAGACAGG + Intergenic
1127661581 15:61104473-61104495 GTGAAGATAAACATGAAAGCTGG - Intronic
1127995159 15:64149675-64149697 ATGAGGTGGAAGATGGAGGCTGG + Intergenic
1127997489 15:64162113-64162135 TTGGAGATGAAGATGTAGGCCGG - Exonic
1128142771 15:65313904-65313926 GGAAAGAGGAAGACGGAGGCCGG - Intergenic
1128590177 15:68888517-68888539 GGCAAGATGGAGATGAAGGCAGG - Intronic
1128955550 15:71939356-71939378 GTCTAGTTGAAGATGGAGGTTGG - Intronic
1129184286 15:73896500-73896522 GAGAAGATGAAGATGATGGTGGG + Intergenic
1129291663 15:74572881-74572903 GTGATGATGCAGATGGAGGCCGG + Exonic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1129417495 15:75394417-75394439 GAGAAGTGGAAAATGGAGGCAGG + Intronic
1129482185 15:75835840-75835862 GTGATGCTGATGATGGGGGCTGG - Intergenic
1129598004 15:76979961-76979983 GACAAGCTGAAGCTGGAGGCAGG - Intergenic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1130977302 15:88787313-88787335 GTAAAGATGGAGGTGGAGACTGG - Intergenic
1131022193 15:89108336-89108358 GTGAAGATGGAAGTGGAGACTGG - Intronic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131797175 15:96030991-96031013 GTGAAGGAGAAGATGGAAACAGG + Intergenic
1132180393 15:99748534-99748556 TTCAAGATGAAGGTGGTGGCAGG - Intergenic
1132913451 16:2328015-2328037 GTAAAGATGAAAATGGCAGCTGG - Intronic
1133294145 16:4742454-4742476 GTGAAGGCGGAGGTGGAGGCAGG + Intronic
1134080745 16:11323375-11323397 GTGCAGATGGAGGTGGAGGCTGG + Intronic
1134235505 16:12462212-12462234 GTGAAGCTGACCATGGAAGCAGG - Intronic
1134569379 16:15278455-15278477 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1134843237 16:17418313-17418335 GAAAAGATTAAGGTGGAGGCTGG + Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134934440 16:18234383-18234405 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135522403 16:23187540-23187562 GTGCAGATGCAGATGGGGGTTGG - Intronic
1135734276 16:24918355-24918377 GTAAAGATGAAAATGTGGGCTGG + Intergenic
1135967750 16:27050071-27050093 ATGAAGCTGAAGGTGGAGGCAGG + Intergenic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136683323 16:31980352-31980374 GTGAAGATGAATTTGGAGAAAGG + Intergenic
1136693264 16:32052394-32052416 GGCAAGTTGCAGATGGAGGCTGG + Intergenic
1136783955 16:32923908-32923930 GTGAAGATGAATTTGGAGAAAGG + Intergenic
1136793755 16:32995617-32995639 GGCAAGTTGCAGATGGAGGCTGG + Intergenic
1136860569 16:33699136-33699158 GTGAAGGTGAGGATGGTGGTGGG - Intergenic
1136876156 16:33858762-33858784 GGCAAGTTGCAGATGGAGGCTGG - Intergenic
1136885827 16:33929898-33929920 GTGAAGATGAATTTGGAGAAAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137857431 16:51808876-51808898 GTGCACATGAAGAGGGAGGGAGG + Intergenic
1138239358 16:55414494-55414516 GTGGAGACGAAGATGTAGTCAGG + Intronic
1138251134 16:55502789-55502811 GTGAAGAAGAAAATGGATCCTGG + Exonic
1138267098 16:55667506-55667528 GTGCTGATGTAGATGGAGGTAGG - Intronic
1138376467 16:56567699-56567721 GTGAGGATGGAGATGGAGTGGGG - Intronic
1139087274 16:63602547-63602569 GTGAAGATGGGGATGGAGGTGGG + Intergenic
1139684761 16:68594298-68594320 GTTAAGATGTTGCTGGAGGCCGG - Intergenic
1140263473 16:73400523-73400545 GCGAAGATGAAAATGTAGCCCGG - Intergenic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1141107576 16:81246123-81246145 TTAAAGATAGAGATGGAGGCCGG - Intronic
1141126259 16:81403243-81403265 GTGAAGATGAAGCTGGGTGATGG + Intergenic
1141475203 16:84268318-84268340 GTCAAGGTGAAGAAGGTGGCAGG - Intergenic
1141650928 16:85392807-85392829 GTGAAGATGGAGCCTGAGGCTGG + Intergenic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1142141263 16:88473804-88473826 GTGAAGGTGAGGATGGGGTCAGG - Intronic
1142197677 16:88746240-88746262 GTGAAGCTGGAGAGGGTGGCAGG + Intronic
1142378416 16:89718508-89718530 GTGGATAAGAAGATGGAGACTGG - Intronic
1203086611 16_KI270728v1_random:1187910-1187932 GTGAAGATGAATTTGGAGAAAGG + Intergenic
1203096017 16_KI270728v1_random:1257310-1257332 GGCAAGTTGCAGATGGAGGCTGG + Intergenic
1203122069 16_KI270728v1_random:1547319-1547341 GTGAAGGTGAGGATGGTGGTGGG - Intergenic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1142853147 17:2714758-2714780 GTTAAGACTATGATGGAGGCCGG - Intergenic
1143289925 17:5820761-5820783 GAGAAGATGAAGAGGCAGGGAGG - Intronic
1143364664 17:6398517-6398539 GTGAAGATGAAGGTGGAGATTGG + Intronic
1143395495 17:6592109-6592131 GTGAGAATGAAAATAGAGGCTGG + Intronic
1144058665 17:11562251-11562273 AGGAATATGAAGTTGGAGGCTGG - Exonic
1144626991 17:16849052-16849074 GTGAAACTGACGATGCAGGCTGG - Intergenic
1144879449 17:18423660-18423682 GTGAAACTGACGATGCAGGCTGG + Intergenic
1144942019 17:18948495-18948517 GTAAAGATGAAGCTGTGGGCTGG + Intergenic
1145088932 17:19970171-19970193 GGGAAGATGAAGACTGAGGTAGG - Intronic
1145152792 17:20520727-20520749 GTGAAACTGACGATGCAGGCTGG - Intergenic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1147144232 17:38476063-38476085 GTGAAGATGAATTTGGAGAAAGG + Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147429283 17:40361815-40361837 GGGAGGATGAAGATGGAGGAGGG + Intronic
1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG + Exonic
1148336684 17:46846776-46846798 GTGAGGAAGAAGAGGGAGGGAGG + Intronic
1149714244 17:58772160-58772182 GTTAAGATATAGATGCAGGCTGG + Intronic
1151651096 17:75470164-75470186 TTGAAAATGAAGGTTGAGGCTGG + Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152005159 17:77675962-77675984 GTGAAGAAGAAGATGTGGGTGGG - Intergenic
1152307276 17:79528692-79528714 GTGAAGATGGAGGCAGAGGCTGG + Intergenic
1152315267 17:79576804-79576826 GAGAAGATGGAGATGGAGATGGG + Intergenic
1152659542 17:81535872-81535894 GTGAAGATGGAGATGGGGATGGG - Intronic
1153580870 18:6572068-6572090 GTTAAAATGAAGGTAGAGGCCGG + Intronic
1154031516 18:10757407-10757429 ATGAAGATGAGGAAGAAGGCTGG + Intronic
1154315070 18:13297925-13297947 CTGAAGCTGAAAGTGGAGGCTGG + Intronic
1155337502 18:24779821-24779843 TTGACAATGAAGATGGAGACGGG - Intergenic
1155399079 18:25418417-25418439 GTGATGATGATGCAGGAGGCAGG + Intergenic
1155551781 18:26972705-26972727 GGGAGGGTAAAGATGGAGGCAGG + Intronic
1155829128 18:30490088-30490110 GAGAAGAAGAAGCTGGAGTCTGG - Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156447615 18:37249033-37249055 GTGAAGGTTGAGCTGGAGGCCGG - Intronic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1157392406 18:47313878-47313900 GTGAATATGAGGATGGGGGTGGG - Intergenic
1157410810 18:47461519-47461541 GTGAAGATGAAGTGAGAGACTGG - Intergenic
1157552163 18:48589366-48589388 GTACATGTGAAGATGGAGGCAGG - Intronic
1157750668 18:50175219-50175241 GTGAAAGTAAAGAGGGAGGCAGG - Intronic
1157806799 18:50664412-50664434 GTGCTGATGAAGATGTTGGCGGG - Exonic
1158212779 18:55069205-55069227 GTGAAGATGAAGGCAGAGACTGG - Intergenic
1158218958 18:55129993-55130015 GTGAAGATGGAGGTGGAGGTTGG + Intergenic
1158296000 18:55997510-55997532 GTGAACTTGAAGAGGGAGGAGGG - Intergenic
1158634945 18:59148202-59148224 GTGAAGAGGAAGATTGAGGCAGG + Intronic
1158665483 18:59429025-59429047 GTGAAGCTGCAGAGGCAGGCGGG + Intergenic
1159578984 18:70213768-70213790 TTGAAGATTAAGATGCTGGCAGG + Intergenic
1159649176 18:70956851-70956873 GTCATGATGAAGTCGGAGGCTGG - Intergenic
1159842046 18:73410248-73410270 GTTAGGATGGAGTTGGAGGCAGG - Intergenic
1159914916 18:74180313-74180335 GTGAAGATGAAGGCGGAGACTGG + Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160382631 18:78472280-78472302 GGGCAGATGACGATGGGGGCAGG - Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160448695 18:78947190-78947212 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1161379027 19:3954844-3954866 GTGAAGATGGAGGTAGAGGCCGG - Intergenic
1161864912 19:6826694-6826716 GTGCAGATGAAGCTGGAGGTGGG + Exonic
1162064029 19:8114070-8114092 GTGAAGATGGAGACAGAGACTGG + Intronic
1162273548 19:9635617-9635639 GGTAAGAACAAGATGGAGGCTGG + Intronic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1162641522 19:12014214-12014236 GGGAAGAGGAAGGTGGTGGCAGG - Intergenic
1162836043 19:13318614-13318636 GTGATGATGATGATGGATGGGGG + Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1164784959 19:30922917-30922939 GTGCTGATGAAGGTGGTGGCTGG + Intergenic
1165434946 19:35790457-35790479 GTGAAGGCCAAGCTGGAGGCAGG - Intergenic
1165570842 19:36773344-36773366 ATGAAGGTGAAGGTGGAGGTGGG + Intronic
1165733878 19:38163757-38163779 GGGGAGATGAAGTTGGAGACCGG + Intronic
1165890387 19:39108605-39108627 GGGAAGATAAAGATGGGGGGTGG + Intronic
1165922726 19:39308687-39308709 GGGAATATGTTGATGGAGGCGGG - Intronic
1166915313 19:46191435-46191457 GTGAGGATGAGGATGAAGGAAGG + Intergenic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167389927 19:49188360-49188382 GTCAAGAAGCAGTTGGAGGCTGG - Intronic
925404742 2:3598726-3598748 GTGGAGAGGAGGCTGGAGGCGGG + Intronic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926780629 2:16467948-16467970 GTCAAGAAGAAAATGCAGGCAGG + Intergenic
927070040 2:19518520-19518542 GTAACAATGAAGATGGATGCTGG - Intergenic
927173068 2:20386702-20386724 GTGAAGATGACCAGGAAGGCTGG - Intergenic
927291428 2:21408540-21408562 TTGAAGATGAGGGTGGAGGAAGG + Intergenic
927450173 2:23202634-23202656 TTGAAGATCAAGATGTGGGCAGG + Intergenic
927984170 2:27395972-27395994 GTGAAAAACAACATGGAGGCTGG + Intronic
928134793 2:28680119-28680141 GTGACTATTAAGATTGAGGCAGG + Intergenic
928255856 2:29721893-29721915 GGGAAGAAGAAGGTGGAGACAGG - Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
928954277 2:36845995-36846017 GTGAGGATGAAGATTGAGTTTGG - Exonic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
929256940 2:39821966-39821988 ATGAAGCTGAAGGTGGAGGGTGG - Intergenic
929411555 2:41702611-41702633 GTGAAGAAGAAGGTGGAGGTTGG - Intergenic
929537193 2:42791231-42791253 GTGAAGACGAAGGTGGAGGTGGG + Intronic
929571502 2:43025892-43025914 CTGACTTTGAAGATGGAGGCAGG - Intergenic
930513302 2:52373599-52373621 TTGAAGCTGAAGATGTAGGATGG + Intergenic
931787005 2:65629194-65629216 GTGAAGATGAAGGCAGAGACTGG - Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932449986 2:71803343-71803365 GGGAAGAGGTGGATGGAGGCTGG + Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
932956198 2:76353715-76353737 GAGAAGGTGAAGATGCAGGTAGG + Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934751995 2:96799552-96799574 GGGAAGGTGGAGGTGGAGGCAGG + Exonic
934768412 2:96893482-96893504 GTGAAAATGAACAGGGAGGCTGG + Intronic
935344576 2:102093948-102093970 GTGAAGCTCAGGACGGAGGCAGG - Intronic
935424680 2:102907526-102907548 GTGAAAATGAAAATGGCAGCTGG - Intergenic
936483824 2:112909649-112909671 GGGAAGATGGAGATGCAGGGAGG - Intergenic
938404000 2:131017318-131017340 GTGAAGGTGAAGGTGGGGGAAGG - Intronic
939603650 2:144225300-144225322 TTGAAGATGATAAGGGAGGCTGG - Intronic
940268164 2:151862045-151862067 GTGAAGATGAGAATGGAGAAAGG - Intronic
940989074 2:160079727-160079749 GTGAATATGAAGACAGAGGTTGG + Intergenic
941047727 2:160695453-160695475 GTGGAGATGGAGATGGAGATGGG + Intergenic
941059973 2:160836078-160836100 ATGATGGTGAAGATGGAGGTAGG + Intergenic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941697899 2:168573011-168573033 GAGAAGAGGAAGGAGGAGGCAGG + Intronic
942248819 2:174030891-174030913 GAGAAGATTAAGTTGGAGGTGGG - Intergenic
942425744 2:175858703-175858725 GAGCAGATGAAGACGGAAGCGGG - Intergenic
942466194 2:176209583-176209605 AAGAAGAGGAAAATGGAGGCCGG - Intergenic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943640045 2:190347839-190347861 CTTAAAATGAGGATGGAGGCTGG + Intronic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
945547879 2:211180488-211180510 GTGGAGGTGAAGATGGATGAGGG + Intergenic
945922793 2:215772947-215772969 TGGAAGATGGAGATGGAGGTGGG - Intergenic
946408990 2:219507221-219507243 GTGAGGAGGAACAGGGAGGCAGG - Intergenic
946465498 2:219908473-219908495 GTGAAGGAGAAGATGAGGGCAGG + Intergenic
946701504 2:222418895-222418917 GTGATGATGAAGGTGGAGACTGG - Intergenic
947266495 2:228288094-228288116 CTGAAGAAGAAACTGGAGGCTGG + Intergenic
947534274 2:230931175-230931197 GTGGAGATGAAGACTGAGCCAGG - Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
947856069 2:233325423-233325445 GTGAAGCTGAATATGGTGTCAGG + Intronic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
948795983 2:240402301-240402323 GGGCAGAGGAAGGTGGAGGCGGG - Intergenic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
1168837345 20:886023-886045 GAGAGGAGGAAGATGGGGGCAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169210203 20:3761831-3761853 GAGAAGTTGAAGTTAGAGGCTGG - Intronic
1170330108 20:15200083-15200105 GTTAAGATAAATTTGGAGGCAGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171056307 20:21910255-21910277 GTAAAGAGGAAGATGAAGGCAGG - Intergenic
1171242723 20:23585066-23585088 GTGGAGGTGAAGCTGGAGACAGG + Intergenic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1172397767 20:34621581-34621603 GTGAGGGTGAGTATGGAGGCAGG + Intronic
1172507679 20:35475708-35475730 TTGAAGGTGAAGAATGAGGCAGG - Intronic
1172685833 20:36753708-36753730 ATCAATAAGAAGATGGAGGCTGG + Intronic
1172695306 20:36818274-36818296 GATAAAATGAATATGGAGGCTGG + Intronic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1173049826 20:39548548-39548570 GTGAAGGTGAAGTAGGAGGTGGG + Intergenic
1173222252 20:41139781-41139803 GTGAGGATGAAGGTGCAGGAAGG + Intronic
1173486358 20:43444163-43444185 GTTTAGATGAGGTTGGAGGCAGG + Intergenic
1173598668 20:44277362-44277384 GTGCAGGAGAAGATTGAGGCAGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174045028 20:47727318-47727340 ATGAAGATGAAGGCAGAGGCTGG + Intronic
1174158635 20:48534433-48534455 GTGAAGATGAAGATGGGGACAGG + Intergenic
1174362633 20:50038590-50038612 GGGAAGGTGAAGAGGGTGGCAGG - Intergenic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1175127306 20:56762162-56762184 GTGAAGATGGAGGTGGAGATGGG - Intergenic
1175127502 20:56763406-56763428 GTCAAGATGCTGATGGAGGGGGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175816061 20:61883775-61883797 GGGAGGAACAAGATGGAGGCAGG - Intronic
1175829191 20:61952778-61952800 GTGAAGATGGAGGTGGAGACGGG - Intergenic
1175972276 20:62692666-62692688 GTGTAGAGGAAGAGGGAGGGAGG + Intergenic
1176267421 20:64217484-64217506 GTGAACATGAAGGTGGCAGCAGG - Intronic
1176282601 20:64322746-64322768 GGGAAGAGGGAGCTGGAGGCTGG + Intergenic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1177677351 21:24317638-24317660 GTGAAGGTGAGGTAGGAGGCAGG - Intergenic
1177953956 21:27573798-27573820 ATGGAGATGAAGATGGAGATGGG + Intergenic
1178675961 21:34631841-34631863 GTGAAGATGGAGACAGAGGTTGG - Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1179815899 21:43906024-43906046 GAGAAGATGAAGATGGAAATCGG + Intronic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1180036231 21:45251762-45251784 GAGAAGATGAACAGGAAGGCTGG - Intergenic
1180543179 22:16471881-16471903 GTGAATTTGAGGGTGGAGGCTGG + Intergenic
1180765493 22:18343908-18343930 AAGAGGATGAAGATGCAGGCTGG - Intergenic
1180780823 22:18518484-18518506 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1180813536 22:18775791-18775813 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1180997480 22:19972647-19972669 GTGAAGGTGAAGGAGGAGTCAGG - Intronic
1181054231 22:20252592-20252614 GTGGTGATGAAGATGGGGGTGGG - Intronic
1181167612 22:20991987-20992009 GTGAAGCTGGGGCTGGAGGCCGG - Intronic
1181199720 22:21210121-21210143 AAGAGGATGAAGATGCAGGCTGG + Intronic
1181400041 22:22645737-22645759 AAGAGGATGAAGATGCAGGCTGG - Intronic
1181649323 22:24250053-24250075 AAGAGGATGAAGATGCAGGCTGG + Intergenic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181702015 22:24626835-24626857 AAGAGGATGAAGATGCAGGCTGG - Intronic
1181954105 22:26575697-26575719 TTTAAAATGAAGATGCAGGCCGG + Intronic
1181982847 22:26778321-26778343 GATATAATGAAGATGGAGGCTGG - Intergenic
1182724493 22:32432419-32432441 GTGAGCATCATGATGGAGGCAGG + Exonic
1182771368 22:32798985-32799007 GTAAGAATGAAGATGCAGGCTGG - Intronic
1183267361 22:36836928-36836950 GGGGAGATGAGGAGGGAGGCTGG + Intergenic
1183272850 22:36872785-36872807 GTGAGGATGGAGATTGAGGGTGG + Intronic
1183431449 22:37768391-37768413 GTGAAGAGGTGGGTGGAGGCTGG - Intronic
1183842984 22:40515687-40515709 GTAAAGTTGAAGAGGTAGGCAGG + Intronic
1184135940 22:42549956-42549978 GTGAAGATGAGGATGGGGGCGGG + Intergenic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184391119 22:44204231-44204253 GGGGACATGAAGATGGAGGGCGG - Intronic
1184533179 22:45070014-45070036 GTGAAGTTGGCGTTGGAGGCCGG + Intergenic
1184968295 22:47997110-47997132 GTGAAGATGGAGGCAGAGGCTGG + Intergenic
1185131124 22:49039418-49039440 GTGAAGATGATAAAGGAAGCAGG - Intergenic
1185408386 22:50670661-50670683 GTGGACTTGTAGATGGAGGCTGG + Intergenic
1203227115 22_KI270731v1_random:84798-84820 AAGAGGATGAAGATGCAGGCTGG - Intergenic
1203263636 22_KI270734v1_random:1473-1495 AAGAGGATGAAGATGCAGGCTGG + Intergenic
949914310 3:8945764-8945786 TTAAAAATGAAGATGGAGGCCGG - Intronic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
950362118 3:12456856-12456878 GTGAAGCTGAAGGTGGACGGTGG - Intergenic
950519143 3:13485969-13485991 ATTAAGATGAAGAAGTAGGCCGG + Intronic
950828203 3:15847779-15847801 TTGAAGGTGAAGCTGGAGGCAGG - Intronic
952272309 3:31845210-31845232 GAGCAGGAGAAGATGGAGGCAGG - Intronic
952419049 3:33114700-33114722 GTTGAGATGAAGAAGGAGACAGG - Intronic
952656075 3:35786824-35786846 GTGAGGGAGAAGTTGGAGGCAGG + Intronic
952878781 3:37970028-37970050 CTGAAGATGAAGTGAGAGGCAGG - Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953261872 3:41347577-41347599 GTGAGGATGAGTATGGTGGCAGG - Intronic
953450506 3:43001538-43001560 GTGAACATGAAGCTGCAGACAGG + Intronic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
954973919 3:54675275-54675297 GTGAAGATGAAGTTGAGGGTAGG + Intronic
955028660 3:55195323-55195345 CTAAAGATGGTGATGGAGGCTGG + Intergenic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
956730179 3:72189299-72189321 GTGTAGTTGGAGATGGAGGTAGG - Intergenic
956786089 3:72643594-72643616 GGGAAGATGAGGAGGGAGCCAGG + Intergenic
957167209 3:76690504-76690526 TTCAAGATCAATATGGAGGCAGG - Intronic
958253794 3:91301078-91301100 GTGAGGGTGAAGATGTAGTCAGG - Intergenic
959572473 3:107899725-107899747 GTGAAATTAAAGAAGGAGGCAGG - Intergenic
959622542 3:108413775-108413797 GTGAAGATGGACAGGGAAGCTGG - Intronic
960003745 3:112760773-112760795 GTGAAGATGAAGGCAGAGGTTGG - Intronic
960914023 3:122679468-122679490 GTGAAGGGGAAGAAGGAGCCAGG - Intergenic
960968181 3:123120094-123120116 GGGAAGAGGCAGATGGAGACAGG - Intronic
961398235 3:126613350-126613372 GGGAAGATGGGGATGGAGGAGGG - Intronic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963460090 3:145601413-145601435 GTGAAGATGCAGGTAGAGGTTGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
964292795 3:155199945-155199967 GTGAAGATGAAGGCAGAGACTGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
966154408 3:176900312-176900334 GGTAAGATGAAGATGGAGGTTGG - Intergenic
966458314 3:180143518-180143540 GTGAAACTTAAGATGAAGGCAGG - Intergenic
966797425 3:183728974-183728996 GTCAAAATGTAGTTGGAGGCCGG + Intronic
966906556 3:184530371-184530393 GGGAGGAGGAAGATGGAGGGGGG + Intronic
966906564 3:184530391-184530413 GGGAGGAGGAAGATGGAGGGGGG + Intronic
966906575 3:184530431-184530453 GGGAAGAGGAAGATGGAGCAGGG + Intronic
967143250 3:186582155-186582177 GTGAACATTAAGATGGAGTAAGG - Intronic
967555696 3:190855325-190855347 GTCGAGATGAGGAGGGAGGCTGG - Exonic
967875617 3:194266534-194266556 TAGAAGATAAAGATGGAGGGAGG + Intergenic
968020068 3:195378045-195378067 GTGAAAAAGAAGAGGGAGGGAGG + Intronic
968029818 3:195474122-195474144 GTGAAAGTGAAGACAGAGGCCGG - Intergenic
968751239 4:2390156-2390178 GTGAAGATGGAGGTGGAGACTGG + Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969340714 4:6539207-6539229 GTGAGGATGGAGGTGGAGGTTGG + Intronic
969355516 4:6623059-6623081 GTCAAGAAGACTATGGAGGCTGG + Exonic
969702982 4:8777867-8777889 GTGGACATGACGATGGAGGTCGG - Intergenic
971029550 4:22621547-22621569 GGGAGGGTAAAGATGGAGGCAGG + Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971256839 4:25022227-25022249 GGGAAGAGGAAGATGGAGAATGG + Intronic
971392586 4:26199980-26200002 CTGCAGTTGATGATGGAGGCCGG + Intronic
972363892 4:38355393-38355415 GGGAATGTGAGGATGGAGGCAGG + Intergenic
972405002 4:38737104-38737126 GTGAAGATGAAGGCAGAGACTGG + Intergenic
972480347 4:39490664-39490686 GGGAAGAAAAAGATGGAAGCAGG - Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
972683380 4:41328536-41328558 GTGAAGATGAATGTGGAGAAGGG + Intergenic
973243435 4:47983826-47983848 TTGAAGAAGAAAATGAAGGCTGG + Intronic
973319125 4:48792335-48792357 GTGAAGAGGAAAGAGGAGGCAGG + Intergenic
974895669 4:67935247-67935269 GTGGTGTTGAAGATGGAGCCAGG - Intronic
976035236 4:80810554-80810576 GTGAAGATGAAGGCAGAGACTGG + Intronic
976403494 4:84635711-84635733 ATGAAGATGAAAAGGGAGGGAGG - Intronic
976531476 4:86158293-86158315 GCTAAGATCAAGATGGTGGCAGG - Intronic
978353020 4:107840414-107840436 GTGAAAATGTATATGGAGGAGGG - Intronic
978560792 4:110031564-110031586 GTGAAGCTGGAGATGTGGGCTGG + Intergenic
978609960 4:110526564-110526586 GTGAAGACGAAGAGGAAGGCAGG + Intronic
979220182 4:118214225-118214247 ATGAAGATGAAGAAGAAGGTAGG + Intronic
979288259 4:118951026-118951048 GGGAGGAGGCAGATGGAGGCAGG + Intronic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
980955041 4:139419380-139419402 GTGAAGGTGAAGGAGCAGGCAGG - Intronic
981151618 4:141385163-141385185 GTGAAGATGAAGATAGAGATTGG + Intergenic
981613957 4:146626551-146626573 TTCAAGATCAAAATGGAGGCTGG - Intergenic
982074224 4:151722473-151722495 ATGAAATTGAAGATGTAGGCAGG - Intronic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
983007769 4:162506614-162506636 GGGAAGATGAAGAGGGATACAGG - Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984665328 4:182421189-182421211 GTGAAGATGAAGATGAAGAGGGG - Intronic
984775754 4:183480466-183480488 GGGAAGCTGAAGAGGGAGGATGG + Intergenic
984811758 4:183801611-183801633 GTGCAGATGGAGATGGGGGTGGG + Intergenic
984934771 4:184880585-184880607 GGGAAGATGCAGGCGGAGGCTGG - Intergenic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985400650 4:189590118-189590140 GGGAGGGTGAGGATGGAGGCTGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985956780 5:3271638-3271660 GTGAAGATGAAGGCAGAGACGGG + Intergenic
985970892 5:3377574-3377596 ATGGAGATGAAGATGCAGGGAGG + Intergenic
986220560 5:5765321-5765343 GTGATGCTGGAGATGTAGGCAGG + Intergenic
986310006 5:6544690-6544712 ATGAAGATGGAGGTGGAGACCGG + Intergenic
986467719 5:8043302-8043324 GTGAAGATCAAAATCAAGGCAGG + Intergenic
986517687 5:8581073-8581095 GTGAATGTTAAGAGGGAGGCAGG - Intergenic
986689229 5:10300214-10300236 GTGAAGATGGAGGTGGAGATGGG + Intronic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
986802514 5:11276819-11276841 GTGAAGATGGAGGTGGAGATTGG + Intronic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
987177155 5:15325464-15325486 CTGAAGATGATGATAAAGGCTGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987243097 5:16021130-16021152 TTGAAGATGGAGGTGGGGGCAGG - Intergenic
987650152 5:20730834-20730856 GTGGAGAGGAACATGGATGCTGG + Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988006551 5:25418906-25418928 GTGAAGTTGAAGATCAAGGTAGG - Intergenic
988745407 5:34130633-34130655 GTGGAGAGGAACATGGATGCTGG - Intergenic
988925842 5:35990660-35990682 GTGAAGCTGCATATGGAGCCAGG - Intronic
989596129 5:43157842-43157864 GTGAAGATGAAGGCAGAGACTGG - Intronic
989993306 5:50795381-50795403 ATGAAGATGAAGATGGTGTTAGG - Exonic
992077707 5:73206454-73206476 GATAAGTGGAAGATGGAGGCAGG - Intergenic
992263327 5:74992394-74992416 GTGAAGATGGAAGTGGAGACTGG - Intergenic
992568881 5:78031289-78031311 GTGGACATGAAGTTGGAGGCAGG + Intronic
992923177 5:81549255-81549277 ATGAAGAGAAAGATGAAGGCAGG - Intronic
993808989 5:92451766-92451788 GGGAAGTTGCAGATGGAGGTTGG - Intergenic
994777417 5:104051597-104051619 CTGATGATGATGATGGAGGTGGG - Intergenic
995390163 5:111632074-111632096 GTGAGGATGCAGAGGAAGGCAGG - Intergenic
995914522 5:117228500-117228522 GTAAAAATGCAGATGCAGGCTGG + Intergenic
996491942 5:124108112-124108134 GTGAAGATGAGGGTGAAGACGGG - Intergenic
996945783 5:129065939-129065961 TTGGCCATGAAGATGGAGGCAGG + Intergenic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
997655044 5:135548308-135548330 GTGATGCTGATGATGGAGTCAGG - Intergenic
997679266 5:135737838-135737860 GTGCTGATGAAGTAGGAGGCTGG - Intergenic
998303907 5:141053823-141053845 GGGGAGATAAAAATGGAGGCTGG + Exonic
998572874 5:143280063-143280085 GGGAAGAGGGAGATGGAGACTGG - Intronic
999371982 5:151061335-151061357 GGGAAAATGTAGATGGAGGAGGG - Intronic
999823920 5:155256128-155256150 GTGAAGATGAAGACAGAGATCGG - Intergenic
1000887118 5:166759799-166759821 GTAAAGATGAGGAGGAAGGCCGG - Intergenic
1001057071 5:168458452-168458474 GTGAAGATGAAGATCGAACAAGG - Intronic
1001104713 5:168843285-168843307 GTGAAGAGGAAGGTGGAGGGAGG + Intronic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1002339415 5:178505189-178505211 GTGAAGATGAAGGTGGAGATGGG - Intronic
1003136729 6:3439938-3439960 GGGATGATGGGGATGGAGGCAGG + Intronic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003802181 6:9682383-9682405 GGAAAGCAGAAGATGGAGGCTGG + Intronic
1003995839 6:11538272-11538294 GGGAAGATGAAGGCGGAGGGGGG + Exonic
1005398321 6:25406366-25406388 GTGAGGCTGGAGGTGGAGGCAGG + Intronic
1005543523 6:26838385-26838407 GTGGAGAGGAACATGGACGCTGG - Intergenic
1006168762 6:32081269-32081291 GAGAAGGCGAAGATGGAGGGAGG + Intronic
1006629957 6:35423975-35423997 GAGAAGAGGAAGCTGGTGGCAGG + Exonic
1007174026 6:39884179-39884201 GGGAAGGGGAAGATGGAGGAAGG - Intronic
1007593859 6:43039495-43039517 GTGACGGGGAGGATGGAGGCAGG - Intronic
1007808035 6:44465339-44465361 GTGAAGATGAAAACAGAGACTGG - Intergenic
1008923024 6:56862538-56862560 ATGAAGATGAAGATGAAGTCTGG - Intronic
1009356575 6:62754913-62754935 GTGAATCTGATGATGGAGACAGG - Intergenic
1009503374 6:64444895-64444917 GTGGAGGTGAAGTGGGAGGCAGG - Intronic
1010415058 6:75602513-75602535 GGGAGGAGGAAGATGGCGGCCGG + Exonic
1011278907 6:85657205-85657227 GTGATGATAAAGGTGGAGGTTGG - Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1013660565 6:112292152-112292174 GAGAAGATCAAGCTGGAGGCAGG - Intergenic
1013881417 6:114906283-114906305 GTGAAGATGAAGAGGTGGGTAGG - Intergenic
1014002625 6:116382006-116382028 GTGAAGATGAAAATAGAGATTGG - Intronic
1014116757 6:117675494-117675516 GGGAGGAGGAAGATGGCGGCGGG + Exonic
1014286334 6:119503201-119503223 GCTAAGGTGAATATGGAGGCTGG + Intergenic
1014554176 6:122825876-122825898 GAGATGTTGAAAATGGAGGCAGG - Intergenic
1014733915 6:125068945-125068967 GTGAAGATGAAGCTGAAGGAGGG + Intronic
1015134340 6:129850911-129850933 GAGAAGATGAGGCTGGAGGACGG - Intronic
1015300754 6:131650768-131650790 GTGAAGATGAAGGCAGAGCCTGG - Intronic
1015454978 6:133416206-133416228 AAGAAGATGAAATTGGAGGCAGG + Intronic
1015589647 6:134810693-134810715 GTGAAGATGAAGACAGAGATGGG + Intergenic
1015605384 6:134950144-134950166 GTAAAGGGGAAGATGGGGGCTGG - Intergenic
1015750582 6:136554457-136554479 GTAAATAAGAAAATGGAGGCTGG - Intergenic
1016071707 6:139747258-139747280 GTGAGGCTGAAGATGCAGGCAGG + Intergenic
1016359439 6:143251787-143251809 GTGTAGATGTAGATGGTGGGAGG - Intronic
1016397654 6:143642714-143642736 GTGAAGATGAAGACAGAGATTGG + Intronic
1016615963 6:146048743-146048765 TTGAAGATGAAGACGGAGATTGG + Intronic
1016779812 6:147944912-147944934 GTGAAGATGGAGGCAGAGGCTGG - Intergenic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1017876196 6:158526218-158526240 GTGAAGAAGAATGTGAAGGCTGG + Intergenic
1018362611 6:163087230-163087252 GAGAAGATGAGGATGGAGACTGG + Intronic
1018417952 6:163617639-163617661 GTGATGATGGAGGTGGAGACTGG + Intergenic
1018674367 6:166206221-166206243 GTGAAGACGGAGGTGGAGACCGG - Intergenic
1018755145 6:166842354-166842376 GTGAAGATGGAGGTGGAGACTGG + Intronic
1019459972 7:1152684-1152706 GTGAAGATGAAGGTGGAGACGGG + Intronic
1019795820 7:3047583-3047605 GTGAAGCTGGGGATGGTGGCAGG + Intergenic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1020831985 7:13103925-13103947 GTGAAGATGAAGACAGAGATTGG + Intergenic
1021178896 7:17483334-17483356 GTGAGGAGGAAGCTGGAGCCAGG - Intergenic
1021381108 7:19967509-19967531 GTGAAAATGAAGAGGGATGACGG - Intergenic
1021423237 7:20468952-20468974 GTAAAGAAGAAGCTGCAGGCTGG - Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021774199 7:24035904-24035926 GTGAAGATGAAGATGGGACAAGG + Intergenic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022243059 7:28531411-28531433 ATGAACATGAAGGTGGAGACTGG - Intronic
1022328900 7:29359270-29359292 AGGAAGATGAAAATGGATGCTGG + Intronic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1024049728 7:45610858-45610880 GTGGAGATGATGGTGGAGGTGGG + Intronic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024565042 7:50673804-50673826 GAGATGATGCAGATGGGGGCCGG - Intronic
1024654584 7:51439848-51439870 GTGAAGATGAAAGCGGAGACGGG + Intergenic
1024850955 7:53716426-53716448 GTGAGGAAGAAGTTGGAGGGTGG - Intergenic
1026143980 7:67729686-67729708 GAGCAGATGAAGGTGGATGCAGG + Intergenic
1026638334 7:72103745-72103767 GAGAAGATGGAAATGGAGGGGGG + Intronic
1026845125 7:73694389-73694411 GTCAAGATGAGGATGCAGGAAGG - Intronic
1027196662 7:76035266-76035288 GTGAAGATGAAACTGGAGGGAGG - Intronic
1027823753 7:83084017-83084039 GGAAAGATGAAGATGAAGGCTGG + Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028937659 7:96484302-96484324 GTGAAGATGAAGTTGAAAACAGG - Intronic
1028965376 7:96796155-96796177 GTGAAGATGGAGGCAGAGGCTGG + Intergenic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029969337 7:104773732-104773754 GTGAAGATGAAGGTGGAGATCGG + Intronic
1030902675 7:115143935-115143957 TAGAAGATGAAAATGCAGGCTGG - Intergenic
1030979840 7:116173586-116173608 GGGAAGATGGAGATTGAAGCCGG - Intergenic
1031453513 7:121951663-121951685 GAGGAGATGAAGAGGCAGGCTGG - Intronic
1031915544 7:127559682-127559704 GTTCAGAAGAAGGTGGAGGCTGG - Intergenic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1032544235 7:132728466-132728488 GTCAAGAGGGAGGTGGAGGCAGG + Exonic
1032658839 7:133961170-133961192 TTGAAGATGAGGAAGGAGCCAGG + Intronic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1032741794 7:134747321-134747343 GTCAAGATGCACATGGAGCCAGG + Intronic
1032932820 7:136694118-136694140 CTGAAGAGGAAGATGAATGCGGG - Intergenic
1034181628 7:149143481-149143503 GTCAAGATGCAGATGGAAACTGG + Intronic
1034455722 7:151168531-151168553 GGGAAGTTGGAGATGGAGGAGGG - Intronic
1034509736 7:151523961-151523983 GTGAAGACCAAGGTGGAGACTGG + Intergenic
1034542428 7:151767111-151767133 GTGAAGATGAAGGCGGAGACTGG + Intronic
1034655004 7:152722280-152722302 GTGAGGCTGGAGATGTAGGCAGG + Intergenic
1034861386 7:154597854-154597876 GTGAAGACGAAGGCAGAGGCTGG - Intronic
1035972737 8:4269359-4269381 ATGAAGATGAAAATGGAGCCAGG - Intronic
1036158225 8:6362356-6362378 GGGCAGATGAAGAGGGAGGGTGG - Intergenic
1037579890 8:20238872-20238894 GGGAAGCTGATGAAGGAGGCAGG + Intergenic
1037592863 8:20328137-20328159 GAGAAGATGATGACAGAGGCAGG - Intergenic
1037660812 8:20925198-20925220 TTCAAGATCAAGGTGGAGGCAGG + Intergenic
1037932391 8:22889366-22889388 GAGAAGAGGAAGGTGGAAGCTGG + Intronic
1038072322 8:24030776-24030798 GAGAAGATGAAGATGGATGCAGG + Intergenic
1038281854 8:26172967-26172989 TTGAAAATGAAGATGGAGTGGGG - Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1038666802 8:29544468-29544490 AAGAAGATAAGGATGGAGGCAGG - Intergenic
1038950128 8:32404879-32404901 TTTAAGATGAAGATGAAGGCTGG - Intronic
1039106694 8:33997827-33997849 GTGATGATGAAGATAAAAGCAGG - Intergenic
1039378923 8:37066820-37066842 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1039830299 8:41208094-41208116 TTGAGGATGAAGAAGGAGACAGG - Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1041118803 8:54565984-54566006 GTGAAGATGAAGGCAGAGACAGG - Intergenic
1041176586 8:55203275-55203297 GTGAAGATGCAGTTGGGGACTGG - Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042309965 8:67370064-67370086 GAGAAGATCAAGAGTGAGGCTGG - Intergenic
1042711266 8:71719975-71719997 GTGGACATGAAGTCGGAGGCGGG + Intergenic
1043331721 8:79124711-79124733 GTGAAGGTGGAGATGGAGAAAGG + Intergenic
1044741261 8:95328739-95328761 GTGAAGAAGAAGTTGAAGGATGG + Intergenic
1044885350 8:96771015-96771037 GAGAAGAGGAGGCTGGAGGCAGG + Intronic
1044885450 8:96772139-96772161 GAGAAGAGGAGGCTGGAGGCAGG + Intronic
1044987385 8:97767495-97767517 AAGAAGATGATGAGGGAGGCTGG + Intergenic
1045237036 8:100361261-100361283 GTGGTGATGGAGAGGGAGGCAGG + Intronic
1045816248 8:106280478-106280500 GAGATGATGAAGATGGAGACTGG - Intronic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1047494089 8:125397345-125397367 GTGAAGATGGAGGTAGAGACTGG - Intergenic
1048020402 8:130533211-130533233 GTGAAGATGAAGGCAGAGACTGG + Intergenic
1048887077 8:138917213-138917235 GTTAAGATCAAGGTGGTGGCAGG + Intergenic
1049012898 8:139899455-139899477 GTGAAGATAAGGATGAAGGATGG - Intronic
1049838354 8:144754656-144754678 ATGAAGATGAAGAGGTGGGCAGG + Intronic
1049958778 9:718415-718437 GGGAAGCTGAAGAGGGAGGATGG - Intronic
1050340432 9:4632297-4632319 TTCAAGATGAAGCTGAAGGCCGG + Intronic
1050516920 9:6454357-6454379 GGAAAGATGATGATTGAGGCTGG + Intronic
1050628946 9:7538555-7538577 TTGAGAGTGAAGATGGAGGCAGG + Intergenic
1050811332 9:9751667-9751689 GTGAAGATGAAGACAGAGATTGG + Intronic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055164842 9:73178627-73178649 CTGAAGCTGAAAATGGAGGATGG + Intergenic
1055188797 9:73492127-73492149 GAGAAGATGAAAGGGGAGGCAGG + Intergenic
1055314513 9:75020560-75020582 TTGAAAATGAAAATGAAGGCTGG - Intronic
1055443908 9:76363878-76363900 TTGAAAAAGAGGATGGAGGCAGG + Intergenic
1056159230 9:83871996-83872018 CTTAAGATGTGGATGGAGGCTGG - Intronic
1056351343 9:85751930-85751952 CTTAAGATGTGGATGGAGGCTGG + Intergenic
1056618695 9:88191729-88191751 GTGCAGTTGAGGAAGGAGGCTGG - Intergenic
1056986951 9:91372090-91372112 GAGAACATGAACAGGGAGGCAGG - Intergenic
1057491979 9:95527540-95527562 GTGAAGACAGAGATGGAGACTGG - Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1057968115 9:99524476-99524498 ATGATGATGAAGATGATGGCTGG + Intergenic
1058436725 9:104970072-104970094 GTGGAGATGAAAATAGAGGTAGG + Intergenic
1058511579 9:105724336-105724358 TTGAAAATGAAGGTTGAGGCTGG + Intronic
1058766416 9:108186826-108186848 GTGGAGATGCAGCTGGAGGCAGG - Intergenic
1058847710 9:108978421-108978443 GTAAAGATGATGAAGGAGGGTGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1059822345 9:117987095-117987117 GTGCAGATAAGGATAGAGGCAGG - Intergenic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1060990321 9:127845267-127845289 GGGAAGGTGAGGAAGGAGGCCGG - Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061955603 9:133959793-133959815 GAGAAGATGAAGGCAGAGGCTGG + Intronic
1062425966 9:136506407-136506429 GTGAGGAGGAGGATGAAGGCCGG + Intronic
1185689005 X:2137638-2137660 GTGATGATGATGATGGGGGGAGG - Intergenic
1185691132 X:2156041-2156063 GTGAAGATGGAGACAGAGACGGG - Intergenic
1185745100 X:2566294-2566316 GAAGAGATGAAGATGGAGGCGGG - Intergenic
1185815350 X:3150037-3150059 GTGAAGATGGAGATGGAGATTGG - Intergenic
1187056271 X:15744040-15744062 GTGAAGGTGAGGATGAAGTCAGG + Intronic
1187495039 X:19788352-19788374 GTGAAGATGAAGACAGAGACTGG + Intronic
1188004287 X:25006609-25006631 GTGACAAGGAAGATGGAGTCTGG + Intronic
1188383832 X:29531813-29531835 GTGAAGATAAAGGCAGAGGCTGG - Intronic
1188755090 X:33952573-33952595 GTGAAAATGAAGGGGGAGGGGGG + Intergenic
1189285277 X:39847807-39847829 GTGATGATGAAGAAGGAGAGAGG + Intergenic
1190155413 X:47987874-47987896 GTAAAGTTAAAGATGAAGGCTGG + Intronic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192318785 X:70072215-70072237 AAGAAGCTGAAGAGGGAGGCAGG + Intergenic
1192433246 X:71126496-71126518 GGGGAGATGAGGGTGGAGGCAGG + Intronic
1193730353 X:85095528-85095550 GACTAGATAAAGATGGAGGCCGG + Intronic
1193926375 X:87490735-87490757 ATGATGATGATGATGGAGGGAGG + Intergenic
1194217404 X:91148035-91148057 GTGAACATGTGCATGGAGGCTGG - Intergenic
1194776805 X:97975412-97975434 TTGAAGATGACGATGGAGTTTGG - Intergenic
1194886861 X:99326434-99326456 GTGAAAAGCAAGATGGAGTCAGG + Intergenic
1195431079 X:104790247-104790269 GGGAAGAAAAAGATGGATGCTGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1198235391 X:134732112-134732134 GTGCAGATGGAGGTGGGGGCTGG + Intronic
1199000675 X:142632692-142632714 GTGAGGATTAACATGGGGGCAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199691487 X:150312182-150312204 GTGAAGATGGAGGTAGAGACTGG + Intergenic
1199824445 X:151484480-151484502 GTGGAGTTGAAGGTGGAGGACGG - Intergenic
1199928853 X:152497348-152497370 GCCAAGCTGAAGATGGAGGTGGG - Intergenic
1200182353 X:154158468-154158490 GTGAAGATGAAGGCAGAGACTGG - Intronic
1200188007 X:154195582-154195604 GTGAAGATGAAGGCAGAGACTGG - Intergenic
1200193657 X:154232722-154232744 GTGAAGATGAAGGCAGAGACTGG - Intronic
1200199412 X:154270526-154270548 GTGAAGATGAAGGCAGAGACTGG - Intronic
1200553918 Y:4611827-4611849 GTGAACATGTGCATGGAGGCTGG - Intergenic
1201265948 Y:12206689-12206711 GTGAAGATGGAGATGGAGATCGG + Intergenic