ID: 1104401588

View in Genome Browser
Species Human (GRCh38)
Location 12:128480914-128480936
Sequence CTGTCAGCTCAGAGAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104401578_1104401588 24 Left 1104401578 12:128480867-128480889 CCAAAAAGGATTCGGCTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG 0: 1
1: 0
2: 3
3: 34
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104401588 Original CRISPR CTGTCAGCTCAGAGAGGGTG GGG Intronic
901479803 1:9517273-9517295 TTGTCAGGTCAGAGACTGTGTGG - Intergenic
903557801 1:24206186-24206208 CTGTCAGCTGAGAGGGAGGGAGG + Intergenic
905442417 1:38004034-38004056 CTGTCAGCTTCTAGAAGGTGGGG - Intronic
905887139 1:41497382-41497404 CGGGCTGCTCTGAGAGGGTGCGG + Intergenic
905995281 1:42376004-42376026 CTTACAGCGCAGGGAGGGTGGGG + Intergenic
906568633 1:46818046-46818068 CTGGGAGATCAGACAGGGTGGGG + Intronic
906637488 1:47418966-47418988 CTGGAAGTTCAGAGTGGGTGGGG - Intergenic
907134093 1:52122777-52122799 CTGTCTGCCCAGACAGGGAGGGG + Intergenic
907797188 1:57729405-57729427 CTTTCAGTGCAGAGAGGATGTGG - Intronic
909215301 1:72879029-72879051 CTCACAGCTCTGAGATGGTGTGG + Intergenic
910464657 1:87485323-87485345 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
911348085 1:96721471-96721493 CAGTCAGGGCAGAGAGAGTGTGG + Intergenic
911618298 1:100038423-100038445 CCGGCAGCTCGGACAGGGTGGGG - Intronic
912387735 1:109280711-109280733 TTGACAGCTCTGGGAGGGTGAGG + Intronic
913241575 1:116834761-116834783 CTTTCAGCTTAGACAGTGTGTGG + Intergenic
913523227 1:119665969-119665991 CTGTGAGCTCTGGGAGGGTAAGG + Intronic
913583261 1:120248343-120248365 CAGTGTGCTCAGAGTGGGTGTGG + Intergenic
913624911 1:120649979-120650001 CAGTGTGCTCAGAGTGGGTGTGG - Intergenic
914359431 1:146920035-146920057 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
914494318 1:148179840-148179862 CTGTCACCTCAGAAGGGGTTTGG - Intergenic
914565248 1:148860179-148860201 CAGTGTGCTCAGAGTGGGTGTGG + Intronic
914607577 1:149270069-149270091 CAGTGTGCTCAGAGTGGGTGTGG - Intergenic
915674304 1:157516043-157516065 CTGTCAGTGCTGAGAGGCTGAGG - Intronic
915936374 1:160092439-160092461 CTGTCAGCGTAGAGCTGGTGGGG - Exonic
916740713 1:167644830-167644852 ATGTCAGCTTAGACAGGGAGAGG - Intronic
917406301 1:174711381-174711403 CTGTCACCTCTCAGAGGGAGAGG + Intronic
919784684 1:201251779-201251801 CTGTCAGCTGAGAGGGGCAGTGG + Intergenic
920294350 1:204946780-204946802 CTGGCAGCCCAGGGATGGTGGGG - Intronic
922494036 1:226041994-226042016 AGCTCAGGTCAGAGAGGGTGGGG + Intergenic
922597592 1:226825861-226825883 CTGTCAGCACAGAGAGGTCTGGG - Intergenic
923065998 1:230517957-230517979 CAGTCAGCTGAGAGAGGAGGGGG - Intergenic
923079991 1:230644074-230644096 CTGTCAACTCAGAGTGGGAAAGG - Intronic
923506914 1:234611940-234611962 CTCCCAGCTTGGAGAGGGTGAGG - Intergenic
1062849024 10:729002-729024 ATGGCAGCACAGAGAGGGTGGGG - Intergenic
1062849047 10:729078-729100 ATGGCAGCACAGAGAGGGTGGGG - Intergenic
1064183962 10:13144099-13144121 CTGTCACCTGAGAGGGAGTGGGG + Intergenic
1064431977 10:15279085-15279107 CGGTCAGCTCAGAGGTGGTCAGG - Intronic
1064504645 10:16015416-16015438 CTGTAAGCTCCTTGAGGGTGGGG + Intergenic
1064601440 10:16997669-16997691 CTTTCAGGTCAGGGAGGGTGGGG + Intronic
1065968027 10:30784517-30784539 CGGGGAGCTCAGAGGGGGTGGGG - Intergenic
1067105169 10:43361678-43361700 CTGAAAGGTCAGAGATGGTGGGG + Intergenic
1069513092 10:69056664-69056686 CTGTGAGCTCCCTGAGGGTGGGG - Intergenic
1069726994 10:70586511-70586533 CTGTGAGCTCATGGAGGGTAGGG - Intergenic
1069991662 10:72320018-72320040 CTGTCAGAGCAGTGAGGGGGTGG - Intergenic
1070565129 10:77598298-77598320 CTGTCAGCTCCAAGAGGGCAAGG + Intronic
1071435615 10:85646240-85646262 CAGTCTGCTCAGAGAGGCAGCGG + Intronic
1071730962 10:88248000-88248022 ATGTGAGCTCAGAGATGTTGTGG + Intergenic
1073049147 10:100656493-100656515 CTGTCAGCGCCGAGATTGTGCGG - Intergenic
1073534181 10:104260246-104260268 CTGTGAGCTCCTTGAGGGTGAGG + Intronic
1075216449 10:120540477-120540499 CTGTAAGCTCTGCTAGGGTGGGG - Intronic
1075480750 10:122779980-122780002 GTGCCAGCTCAGAGAGGGTTAGG - Intergenic
1075559960 10:123460965-123460987 CTGAGAGGTCAGAGTGGGTGGGG - Intergenic
1076881840 10:133243474-133243496 CTGTCAGGGCAGGGAGGCTGTGG + Intergenic
1077511318 11:2965117-2965139 CTTTCTCCTCAGAGAGGCTGAGG - Intronic
1077888962 11:6405226-6405248 CTGTCAGCATAAATAGGGTGTGG + Intronic
1078139216 11:8679815-8679837 CTGTAAGGTCAGAGAGGGACTGG + Intergenic
1078798387 11:14617080-14617102 CTGCCTGCTGAGAGTGGGTGTGG + Intronic
1079538510 11:21543855-21543877 CTGTCAGCCCAGCTAGGCTGTGG - Intronic
1081968070 11:47181459-47181481 CTGGAAGCTCAGAGAGGCTAAGG - Intronic
1082774733 11:57236414-57236436 CTGTGAGCTCAGAGTGGGCCTGG - Exonic
1083802882 11:65057160-65057182 CCTACAGCTCAGAGAGGGTCAGG + Intronic
1084112998 11:67025438-67025460 CTGGGAGCTCAGTGAGGGTCTGG + Intronic
1084437317 11:69151477-69151499 CTGTCACCTTAGAAAGGCTGTGG - Intergenic
1084658264 11:70531899-70531921 CTGTCAGCTCCGGGAAGGTTTGG - Intronic
1084781253 11:71410316-71410338 CTGTCACCGCAGTGAGGGTCAGG - Intergenic
1085260868 11:75203962-75203984 CTTTCAGCTCTGAGGAGGTGAGG + Intronic
1085545977 11:77318760-77318782 CTGTCAGCTCAGGCCGGGTGTGG + Intergenic
1086534180 11:87824091-87824113 CTGTCTGCACAGAGATGGGGAGG - Intergenic
1088732583 11:112696230-112696252 CTCTCAGCTCTGAGAGGCCGAGG - Intergenic
1089256144 11:117195225-117195247 CTGTGAGCTCCCTGAGGGTGGGG + Intronic
1089769391 11:120792441-120792463 CTGGCAGCTAGGAGAGGGTGTGG + Intronic
1089965816 11:122654526-122654548 AACTCAGCTCAGAGAGGTTGGGG - Intergenic
1090125451 11:124078809-124078831 CTGTCATTCCAGAGAGGGTCTGG - Intergenic
1090451643 11:126811366-126811388 CTGTAAGCTCCAAGAGGGTAGGG + Intronic
1090693688 11:129214526-129214548 CTTTCAGCACAGAGAGATTGAGG + Intronic
1094817953 12:34205166-34205188 CTGGCAGCTCTGGGTGGGTGGGG + Intergenic
1095556763 12:43516002-43516024 CTGACAGGTCAGAGTGGGTAGGG + Intronic
1096109492 12:49020576-49020598 GTGTCAGCGCGGGGAGGGTGGGG - Exonic
1096126002 12:49120161-49120183 CTGTCAGTTGGGAGTGGGTGTGG + Intergenic
1097013390 12:55968616-55968638 CTGTCAGCCCAGAGAGGATAAGG - Intronic
1100402732 12:94246296-94246318 CTGTCAGCCCAGAGAGACTGTGG - Intronic
1100469305 12:94875364-94875386 CTATCAGCACAGATAGGGGGAGG + Intergenic
1101158588 12:101951391-101951413 CTCTCAGCTCAGCCAGGGTTTGG + Intronic
1102788215 12:115621414-115621436 CTGTAAGCTCCAAGAGGGTGGGG - Intergenic
1103718683 12:122961669-122961691 CCATGAGATCAGAGAGGGTGGGG + Intronic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1104706401 12:130950749-130950771 CTGGGAGCTCAGTGAGGTTGTGG + Intergenic
1105729681 13:23200573-23200595 CTATAAGCCCTGAGAGGGTGAGG - Intronic
1106196665 13:27499816-27499838 CTGTCTACTCAGAGAGAGAGTGG - Intergenic
1110457170 13:75702321-75702343 CTTTCATCTCAGAGTGGCTGGGG - Intronic
1110675449 13:78237594-78237616 CTGGCAGCCCACAGAAGGTGGGG + Intergenic
1111268704 13:85853281-85853303 CTGCCAACTCATAGGGGGTGGGG - Intergenic
1111635236 13:90894287-90894309 CTGTCAACTTTGATAGGGTGTGG - Intergenic
1112709876 13:102115279-102115301 TTGTAAGCACAGAGAGGGTGGGG - Intronic
1112796315 13:103060203-103060225 CTTTCAGCCCAGACAGTGTGTGG - Intronic
1112903961 13:104394386-104394408 CTGTGAGCTCACAGAGGCTAGGG - Intergenic
1113204423 13:107898633-107898655 GTGGCTTCTCAGAGAGGGTGAGG + Intergenic
1113415458 13:110125291-110125313 CATTTAGTTCAGAGAGGGTGAGG - Intergenic
1113486049 13:110653017-110653039 CGGTTAGCTCAGCGTGGGTGGGG - Intronic
1113594721 13:111522880-111522902 CTGTCAGCACAGACAGGCTCAGG + Intergenic
1113625928 13:111846314-111846336 CCGTCTGCTCAGTGAGGGAGGGG + Intergenic
1113824440 13:113240229-113240251 CTGTCTGAACAGAGAGGGTGCGG + Intronic
1114592869 14:23884197-23884219 CAGTCAGCTTATAGAGGCTGTGG - Intergenic
1115457153 14:33616643-33616665 CTCTCAGCGCAGAGGGGCTGAGG + Intronic
1115787424 14:36842065-36842087 CTGTAAGCTCACAGTGGATGAGG + Intronic
1119861694 14:77940620-77940642 CTGACAGCTCCAAGAGGATGGGG - Intergenic
1120743813 14:88135904-88135926 CTGGTAGCTCAGGGAGTGTGAGG - Intergenic
1121330905 14:93049334-93049356 CAGTCGGCTCAGAGGAGGTGAGG + Intronic
1121832221 14:97062422-97062444 CTGTCAGCTTCCAGAGGGTAGGG + Intergenic
1122179422 14:99944488-99944510 CTGTCAGCCCAGTGGGGGCGGGG + Intergenic
1122235982 14:100330821-100330843 CTGACAGCTCCAAGAGGGAGGGG + Intergenic
1122488340 14:102096285-102096307 CTGTGAGCTCGGAGGAGGTGAGG - Intronic
1122589098 14:102833154-102833176 CTGTCAGCTCTGTGAAGGGGAGG + Intronic
1122820014 14:104337522-104337544 CTGGCTGCTCAGACAGAGTGGGG - Intergenic
1202890006 14_KI270722v1_random:147595-147617 ATTTCAGATGAGAGAGGGTGAGG + Intergenic
1124346136 15:28922731-28922753 ATGTCTCCTGAGAGAGGGTGTGG - Intronic
1124616889 15:31248544-31248566 CTGTCAACTCAGGGCTGGTGTGG + Intergenic
1126920106 15:53511676-53511698 CTGTCAGAGCAGAGAGGCTCAGG - Intergenic
1127778967 15:62294859-62294881 ATGTCAACTTAGAAAGGGTGGGG - Intergenic
1127864267 15:63019122-63019144 CTGCCAGCTCAGAGATGGGATGG - Intergenic
1128322915 15:66705160-66705182 CTGGGAGCACAGAGAGGGTCAGG + Intronic
1129822930 15:78616984-78617006 CTGACAGCCCTGAGAGGGCGTGG + Intronic
1129927882 15:79382406-79382428 CTGTCAGCCAAGAGAAGGTAGGG - Intronic
1130846916 15:87756181-87756203 CAGTCAGATCAGAGAGACTGTGG - Intergenic
1131358243 15:91765277-91765299 CTTCCAGCTCAGACAAGGTGAGG - Intergenic
1131636514 15:94238608-94238630 CTGTAAGCTCTGAGAGGATGAGG - Intronic
1131995472 15:98128699-98128721 ATGGAAGCTCAGAGAGGTTGAGG - Intergenic
1132558427 16:582813-582835 CCGTCTGCAGAGAGAGGGTGGGG - Intronic
1132691308 16:1183055-1183077 GTGTCGGGTCACAGAGGGTGGGG - Intronic
1132984807 16:2759777-2759799 CTGTCAGCTCCTAGAGGGCAGGG - Intronic
1133318020 16:4895881-4895903 GAGCCAGCTCAGGGAGGGTGGGG - Intronic
1133822162 16:9246469-9246491 ATGTCAGCTCAGCCAGGCTGTGG - Intergenic
1135567374 16:23522072-23522094 CTGACACCTGGGAGAGGGTGAGG + Exonic
1136414563 16:30095672-30095694 CTGCCAGGTCAGCAAGGGTGAGG - Exonic
1136476646 16:30517714-30517736 GTGTGAGCTGAGAGACGGTGGGG + Intronic
1138212314 16:55173870-55173892 CAGTCATCTCAGTGAGGTTGAGG + Intergenic
1139631534 16:68234655-68234677 CTGTTTGCTCATAGAGGGGGTGG + Intronic
1140068308 16:71627758-71627780 CTGTGAGCTAGGGGAGGGTGGGG + Intronic
1140377969 16:74460445-74460467 CTGTCAGTTCAGGCCGGGTGTGG - Intronic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1141038655 16:80652905-80652927 CTGTCAGCCCAGAGGGGCTAAGG + Intronic
1141307429 16:82878923-82878945 CTGTCACCTCAGAGAAGGTGAGG - Intronic
1141651037 16:85393356-85393378 CTGGGAGCCCTGAGAGGGTGTGG - Intergenic
1142319157 16:89369973-89369995 ATGGAAGCTCAGAGAGGCTGGGG + Intronic
1143465999 17:7137187-7137209 CTGTTAGGGCAGAGAGGCTGTGG - Intergenic
1143471486 17:7178488-7178510 CCATCAGCTCAGAAAAGGTGAGG - Exonic
1143620014 17:8075401-8075423 GTGGCATCTCAGAGAGGTTGGGG - Intronic
1143874366 17:9980713-9980735 CTGTAAGCTCCCTGAGGGTGGGG - Intronic
1144088141 17:11829031-11829053 CTGCGAGCTCAGAGTGGGGGTGG + Intronic
1144115216 17:12082379-12082401 TTTTAAGCTCAGAGAGGGTATGG - Intronic
1144502604 17:15802206-15802228 CTGTCCGCTCAGTGAGGGCAGGG - Intergenic
1144829951 17:18125794-18125816 CTGTCAGGTCCCAGATGGTGGGG - Intronic
1147752993 17:42748583-42748605 ATGTCAGCTAAGAAAGGGTCTGG - Intergenic
1148219197 17:45850208-45850230 CTGTCAACTCAGAATCGGTGGGG - Intergenic
1149601060 17:57893223-57893245 TTGTCACCTCAGAGCGGGTGGGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151451033 17:74198450-74198472 ATGTCAGCCCAGAGCGGGTGGGG - Intergenic
1151482663 17:74379573-74379595 CTGTCAGCTCAGACAGCAGGGGG + Intergenic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1152446079 17:80345004-80345026 TTATCAGCTCAGAGATTGTGAGG + Exonic
1154106659 18:11529346-11529368 CTGTCAGCTCTCATAGGGTTTGG + Intergenic
1156395173 18:36692835-36692857 CTGTGAGCTCCGAGGGGGTTTGG + Intronic
1156397457 18:36711505-36711527 ATGTCAGCTTTGTGAGGGTGGGG + Intronic
1156574647 18:38300733-38300755 ATGGAAGCTCAGAGAGGCTGGGG + Intergenic
1157215831 18:45782794-45782816 CTGTCTGCTCAGTGAGTGGGAGG - Intergenic
1157552011 18:48588590-48588612 CAGACAGGTCAGGGAGGGTGGGG - Intronic
1157600491 18:48890213-48890235 CTGGCAGGGCAGAGAGGGGGAGG - Intergenic
1160464653 18:79066370-79066392 CTGTCAGTTGAGTGAGGCTGAGG + Intergenic
1161003585 19:1923500-1923522 CTGTCCTGTCAGTGAGGGTGGGG + Intronic
1161074437 19:2278548-2278570 GGGACACCTCAGAGAGGGTGGGG + Intronic
1161309018 19:3583729-3583751 ATGTCAGCTCCAGGAGGGTGGGG - Intergenic
1161806050 19:6443606-6443628 CTGTGAGCTCTATGAGGGTGGGG + Intronic
1162145857 19:8611632-8611654 CTGAGAGCTCGGAGAGGGCGGGG - Intergenic
1162733025 19:12730275-12730297 CTGTAAGGGCAGGGAGGGTGTGG + Intergenic
1162759646 19:12881114-12881136 CTGCCAGCTCTTAGAGGGTCCGG - Exonic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1163605772 19:18274499-18274521 CTGGCAGCTCTTAGGGGGTGGGG + Exonic
1164510977 19:28897034-28897056 CTGGTAGCTGAGAGTGGGTGAGG - Intergenic
1164794651 19:31015869-31015891 CAGGAAGCACAGAGAGGGTGGGG + Intergenic
1164804089 19:31102791-31102813 ATGTGAGCTCTGGGAGGGTGGGG - Intergenic
1164828464 19:31301652-31301674 ATGGCAGGTCAGAGAGGGTCGGG + Intronic
1165240248 19:34460857-34460879 CTGTCAGATCACAGTGGGTAGGG + Intronic
1165702418 19:37948683-37948705 ATGTCAGCTCCAAGAGCGTGGGG - Intronic
1165991644 19:39818590-39818612 CTGTCTGCTCAGAAGGGCTGTGG - Intergenic
1166356768 19:42232000-42232022 CTCTCAGCCTGGAGAGGGTGGGG - Intronic
1166481658 19:43179314-43179336 CTGAGAGCTCAGAGATTGTGAGG + Intronic
1166484128 19:43198431-43198453 CTGAGAGCTCAGAGATTGTGAGG + Intronic
1166491238 19:43262295-43262317 CTGAGAGCTCAGAGATTGTGAGG + Intronic
1166804991 19:45480945-45480967 CTGTCATCCCAGGGAGGCTGAGG - Intergenic
1166807452 19:45496064-45496086 CTGTGAGCTCAGAGATTGTGAGG + Intronic
1166850773 19:45759648-45759670 CAGTGAGCGCAGAGAGGGTCGGG - Intronic
1166852177 19:45766278-45766300 CAGTCATCTCGGAGAGGGAGGGG - Intronic
1167317191 19:48771298-48771320 CTCTCACCTCCAAGAGGGTGTGG - Intergenic
1168115711 19:54220492-54220514 CTTTGAGCTCAGAGAGGACGGGG + Intronic
1168118697 19:54240238-54240260 CTTTGAGCTCAGAGAGGACGGGG + Intronic
1168152206 19:54455282-54455304 GTGTCAGCTCAGAGTGGCGGTGG + Intronic
1202665422 1_KI270708v1_random:114427-114449 ATTTCAGATGAGAGAGGGTGAGG + Intergenic
925921252 2:8639338-8639360 CTGTCTGCTCAGTGCAGGTGAGG + Intergenic
927491582 2:23524597-23524619 CCTTCAACTCAGAGAGGGGGTGG + Intronic
930198993 2:48534775-48534797 CTGTCTCCTAAGAGGGGGTGAGG + Intronic
932198251 2:69802832-69802854 CTCTCAGCTAGGAGGGGGTGTGG - Intronic
932720714 2:74137390-74137412 CTGAAAGCTCAGAGAGAGAGAGG + Intronic
932823745 2:74922309-74922331 CTGGAAGCTCTGAGAAGGTGGGG - Intergenic
935658350 2:105443947-105443969 TTCTCAGCTCAGGGAGGGAGAGG - Intergenic
935783427 2:106527899-106527921 CTTTCAGCAGAGAGGGGGTGTGG - Intergenic
936290223 2:111217212-111217234 CTGCCAACTCAGAAGGGGTGGGG + Intergenic
936771796 2:115922518-115922540 CTGTCATTTCAGAGAGTGAGAGG + Intergenic
937039970 2:118813591-118813613 ATGTTAGCTCAGAGGGGGTGTGG - Intergenic
937353722 2:121185134-121185156 CTTTAAGCACAGAGAGGATGTGG + Intergenic
938410426 2:131059281-131059303 GAGTCAGCTCAGAGAGGGGCAGG + Intronic
940050033 2:149452274-149452296 CTGTAAGCTGAGAAGGGGTGAGG + Intronic
940204113 2:151183643-151183665 CTGGCAGCTCAAAGAGGAGGAGG - Intergenic
942024038 2:171895136-171895158 CTGTAAGCCCCTAGAGGGTGGGG - Intronic
944885353 2:204057180-204057202 CTGTCAGGCCATACAGGGTGTGG - Intergenic
944899937 2:204203911-204203933 CTGTGTGCTCTGTGAGGGTGGGG - Intergenic
945440740 2:209876030-209876052 AATTCAGCTCAGAGAGGGAGAGG - Intronic
946481060 2:220057241-220057263 CTTTCAGCTCAGAGAGTTTCAGG + Intergenic
947812643 2:233014261-233014283 CTGACAGCTGAGAGGGGCTGAGG - Intronic
948412214 2:237772716-237772738 CTCTCAGCTCTGGGAGGTTGTGG + Intronic
948716187 2:239865192-239865214 ATGTAAGCGCAGCGAGGGTGAGG - Intergenic
948870870 2:240797378-240797400 CTAGGAGCTCAGAGAGAGTGAGG + Intronic
948945062 2:241215204-241215226 CTGTCCGTTCAGAGATGCTGCGG + Intronic
1168955922 20:1834294-1834316 ATGACAGCTTGGAGAGGGTGGGG - Intergenic
1171136410 20:22698708-22698730 GAGTCAGAGCAGAGAGGGTGGGG - Intergenic
1171163502 20:22950277-22950299 ATTTCACATCAGAGAGGGTGAGG + Intergenic
1173447164 20:43129451-43129473 TTGTGGGCTCAGAAAGGGTGTGG - Intronic
1173562974 20:44019517-44019539 CTCTCAGCTGAGACAGGGTTAGG + Intronic
1173615902 20:44402829-44402851 TGGTCAGCTCAGCTAGGGTGAGG + Intronic
1173667768 20:44774945-44774967 CTGAGAGATCAGAGAGGGTGTGG - Intronic
1173748395 20:45456080-45456102 ATGTCAGCTCCAGGAGGGTGGGG - Intergenic
1173866445 20:46315489-46315511 CACTCAGCTCTGAGTGGGTGAGG - Intergenic
1174195217 20:48767998-48768020 CTGCCAGCTCCGTGATGGTGAGG + Intronic
1174362344 20:50036958-50036980 ACTGCAGCTCAGAGAGGGTGGGG - Intergenic
1174396858 20:50252022-50252044 CTGTCAGCTCTGGGAAGGCGGGG - Intergenic
1175389788 20:58619661-58619683 CTGTGAGCCCCGAGGGGGTGGGG - Intergenic
1176035055 20:63032079-63032101 CTGTCCGCACAGAGCAGGTGGGG + Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178920338 21:36734586-36734608 CTGGCAGCTTTGAGAGGGAGGGG + Intronic
1180332134 22:11491347-11491369 ATTTCAGATGAGAGAGGGTGAGG + Intergenic
1181082097 22:20422887-20422909 CTGTGAGCCCCGAGGGGGTGGGG + Intergenic
1181725181 22:24806393-24806415 GGGTCAGCCGAGAGAGGGTGCGG - Intronic
1182052867 22:27326344-27326366 GTGTCAGATCCCAGAGGGTGAGG - Intergenic
1182066387 22:27434438-27434460 CTGTGAGCTCTGAAAGGGTGGGG - Intergenic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1182295004 22:29307272-29307294 CTCTGGGCCCAGAGAGGGTGCGG - Intronic
1182540222 22:31035938-31035960 CTGTGAGCCCAGAGAGGATAAGG - Intergenic
1183363092 22:37393130-37393152 CAGGAGGCTCAGAGAGGGTGAGG - Intronic
1183520023 22:38291472-38291494 CTGTCATCTCAGAGTGGGTGGGG + Exonic
1183667832 22:39255430-39255452 CTGTCAACTCTGAGAGGGCAGGG - Intergenic
1183907139 22:41049982-41050004 ATGGGAGTTCAGAGAGGGTGAGG + Intergenic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184277388 22:43417810-43417832 CTGTCCCATCAGAGAGGCTGGGG + Intronic
950175122 3:10868147-10868169 ATGCCAGCCCAGAGAGGGTATGG + Intronic
950539485 3:13601701-13601723 ATGTCAGCTCCCAGAGGGTAGGG - Intronic
950545114 3:13633623-13633645 CTCTCGGCTCAAACAGGGTGGGG + Intronic
950631269 3:14283665-14283687 CTGTCAGCACAGCCAGGCTGGGG - Intergenic
951419283 3:22464993-22465015 CTGTCATCCCAGAGAGGACGAGG - Intergenic
953746898 3:45581939-45581961 CTGTAAGCTCTGTGAGGGTAAGG - Intronic
954106381 3:48411877-48411899 CCGCCTGCTCAGAGAGGATGTGG - Exonic
954199518 3:49015967-49015989 CTGTACGCACAGAGATGGTGAGG - Exonic
954665825 3:52251362-52251384 CTGTAATCCCAGAGAGGCTGAGG - Intergenic
958170037 3:89927836-89927858 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
958539671 3:95454612-95454634 CTCCCAGCTCTGAGAGGCTGAGG + Intergenic
960710206 3:120520146-120520168 CTGTCTACTCAGAGACAGTGAGG - Intergenic
960906865 3:122610347-122610369 CTGTAAGCTCCTTGAGGGTGGGG + Intronic
960963297 3:123087766-123087788 CTGGCAGCTCTGTGAGTGTGTGG + Intronic
961451014 3:127002327-127002349 CTGTCGGCTGGGAGAGGGGGAGG - Intronic
961636810 3:128338414-128338436 CTGTCGGCACACAGAGGCTGGGG + Intronic
961646993 3:128397979-128398001 CTGTCAGTGCACAGAGGCTGGGG - Intronic
963251052 3:143103904-143103926 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
963852065 3:150219051-150219073 CAGTGAGCTCCGAGAGAGTGTGG + Intergenic
965289811 3:166865040-166865062 CTGCCAACTCTGAGAGGGTGGGG - Intergenic
965541988 3:169880047-169880069 CTGCCAACTCAGAAGGGGTGGGG - Intergenic
967932896 3:194703197-194703219 CTGTCTGCACTGAGAGGCTGAGG - Intergenic
967937129 3:194738206-194738228 ATGTCAGCTCAGAGAGGGAAGGG + Intergenic
968095133 3:195924131-195924153 CTGCCAGCTCTGAGAGGAGGAGG + Intergenic
969160937 4:5258444-5258466 CTGTGAGCCCTGAGAGGCTGTGG - Intronic
969339675 4:6532264-6532286 GTGAAGGCTCAGAGAGGGTGAGG + Intronic
969686042 4:8674821-8674843 TCCCCAGCTCAGAGAGGGTGGGG + Intergenic
970359761 4:15297254-15297276 CCAGCAGCTCAAAGAGGGTGTGG - Intergenic
970507484 4:16746160-16746182 CTGTAAGCTTACTGAGGGTGGGG - Intronic
973647591 4:52965574-52965596 ATTTCAGCTCCCAGAGGGTGTGG + Intronic
973740568 4:53915824-53915846 CAGTTGGATCAGAGAGGGTGAGG - Intronic
974117844 4:57602348-57602370 CTGACAGCTCAGACAGGTTCTGG + Intergenic
976217295 4:82727401-82727423 CTGTATACTCATAGAGGGTGAGG - Intronic
976647212 4:87399352-87399374 CTGCCAACTCAGAAAGGGGGTGG - Intergenic
977296841 4:95219384-95219406 CTTTCGGCTCAGAAAGTGTGAGG - Intronic
978283909 4:107052003-107052025 CTGTAAGCTCAGTGAGAGTGAGG + Intronic
978727527 4:111986795-111986817 CTGTCAGCTCTGAGAGGCAGAGG - Intergenic
979178170 4:117691655-117691677 CTGTCAAACCAGGGAGGGTGAGG + Intergenic
980499717 4:133632806-133632828 CTATAATCTAAGAGAGGGTGAGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981598774 4:146460183-146460205 CTGGCAGCTCAGTGTTGGTGAGG + Intronic
982399306 4:154948664-154948686 CTGTGAACTAAGACAGGGTGTGG - Intergenic
982499261 4:156132394-156132416 CTGGCATCTCAGAAAGGGAGAGG + Intergenic
983168639 4:164510631-164510653 AGGTCAGATCAGTGAGGGTGTGG - Intergenic
983547525 4:168979191-168979213 CTGAGAGCTCAGTGGGGGTGGGG - Intronic
984371028 4:178864242-178864264 CTCTCAGCTGAGAGGGGATGTGG + Intergenic
984620760 4:181949747-181949769 GTGTGAACTCAGAGAGGGTGTGG - Intergenic
986232742 5:5881594-5881616 CTGTGAGGTGAGAGTGGGTGGGG + Intergenic
986324645 5:6663181-6663203 CTGTCAATTCAGAGAGGCTAAGG - Intronic
988491807 5:31711540-31711562 CTGTCAGTGCAGAGAGGTGGAGG + Intronic
988509976 5:31856484-31856506 ATGCAGGCTCAGAGAGGGTGAGG - Intronic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
989547435 5:42690774-42690796 CTGACACCACAGAGAGGTTGGGG + Intronic
993469450 5:88288870-88288892 CTGTCAGAGCAGAGACTGTGGGG - Intergenic
995396624 5:111693871-111693893 ATCTCAGCTGAGAGAGGCTGAGG + Intronic
997602714 5:135151290-135151312 GGGTCAGCTCAGAGAGACTGAGG - Intronic
997665051 5:135623943-135623965 CTGTAAGCTCTGTGAAGGTGAGG - Intergenic
997716376 5:136046261-136046283 CTGTCAGAGAAGGGAGGGTGTGG + Intronic
997736441 5:136215931-136215953 CTGCCAGCTCTGAGGTGGTGGGG + Intronic
997836083 5:137194590-137194612 CTGTCAGCTCCTAGAGGGCAGGG - Intronic
998159509 5:139805492-139805514 ATGTAAGTTCAGTGAGGGTGGGG - Intronic
999283675 5:150381337-150381359 CTGTGAGCTCCTTGAGGGTGGGG - Intronic
1000625634 5:163534906-163534928 ATGTCAGCTAAGGCAGGGTGTGG + Intergenic
1000976111 5:167766169-167766191 ATTTAAGCTCAGAGAGGGTGAGG + Intronic
1001215481 5:169852064-169852086 CTGTCAGCACAGAGAGAGAGAGG + Intronic
1003594345 6:7461115-7461137 CTGTAAGCACCGTGAGGGTGTGG + Intergenic
1004295216 6:14403881-14403903 CTGTCAGCTCAGTGAAGGCAGGG + Intergenic
1004837562 6:19545084-19545106 CTGGCAGCTCAGAGCCCGTGAGG - Intergenic
1005284802 6:24313879-24313901 CTGTAAGCTCAGTGAGAGTGGGG - Intronic
1005636142 6:27755160-27755182 CTCTAAGCACAGAGAGTGTGTGG - Intergenic
1006402785 6:33827409-33827431 CTCTCCGCTGAGAGATGGTGGGG + Intergenic
1006505508 6:34486276-34486298 CTGTCAGCTGAGAGGGAGGGAGG + Intronic
1006852077 6:37105789-37105811 CAGTGAGATCAGAGAAGGTGGGG + Intergenic
1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG + Intergenic
1007687604 6:43676249-43676271 ATGTCTGCTCAGATAGGGTTAGG + Intronic
1007755108 6:44094391-44094413 TTGTCAGCTCCGTGAGTGTGGGG - Intergenic
1009834547 6:68982478-68982500 CTGTCAGCTCTGAGAGACAGAGG + Intronic
1010529976 6:76956321-76956343 CTGTCAAATGAGATAGGGTGTGG + Intergenic
1011023923 6:82845618-82845640 GTGTCAGCTCAGCCACGGTGGGG + Intergenic
1012476413 6:99618960-99618982 CTGTGAGCCCAGGGAGGGCGAGG - Intergenic
1012947187 6:105479341-105479363 CTTTCATCTGAGACAGGGTGTGG - Intergenic
1013989534 6:116237478-116237500 CTGTGAGCTGAGAGATCGTGGGG + Intronic
1015353683 6:132252165-132252187 CTCTCAGCAGAGAGGGGGTGTGG - Intergenic
1015715567 6:136188907-136188929 CTGCCAGCTCGTAGAGGTTGAGG + Intronic
1016187503 6:141215321-141215343 CTGTAATCTCTGTGAGGGTGAGG - Intergenic
1016771991 6:147861966-147861988 ATGACAGCTCAGAAAGGGGGAGG + Intergenic
1017337152 6:153274818-153274840 CTATCATCTCTGAGAGGGTAGGG - Intergenic
1018065068 6:160118885-160118907 CTGCCAACTCAGAAGGGGTGGGG + Intergenic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018380424 6:163253886-163253908 CTCCCAGCTCTGAGAGGGAGGGG + Intronic
1018713841 6:166516503-166516525 CAGGCAGCTCAGAGAGAGAGAGG - Intronic
1019182839 6:170202628-170202650 CTGTAAGCTCAGGGAGGGCGGGG - Intergenic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1019729571 7:2622734-2622756 CTGTGAGCACAGAAAGGCTGGGG - Intergenic
1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG + Intronic
1020220021 7:6229032-6229054 CCCTCTGCTCAGAGGGGGTGTGG - Intronic
1020568128 7:9822825-9822847 CTGCCACCTCAGAAGGGGTGGGG + Intergenic
1020862751 7:13515550-13515572 CTGTCAGATCACACAGGTTGAGG + Intergenic
1021656747 7:22880874-22880896 GTTTCAGCTTAGACAGGGTGAGG + Intergenic
1022127036 7:27368550-27368572 TGCTCAGATCAGAGAGGGTGTGG - Intergenic
1023465790 7:40453105-40453127 CTGTAATGTCAGAGAGAGTGTGG + Intronic
1023628547 7:42140211-42140233 CTGTCAGGGGAGAGAGAGTGAGG - Intronic
1024182485 7:46909964-46909986 CTGTCAGCACAGCTTGGGTGAGG + Intergenic
1024977031 7:55122757-55122779 TTTTCAGCTAAGAGAGGATGAGG - Intronic
1026014957 7:66665559-66665581 CACTCAGCTCAGAGGTGGTGAGG - Intronic
1026027779 7:66761238-66761260 GTGTCAGATCACACAGGGTGAGG + Intronic
1026891706 7:73986255-73986277 ATCCCAGCTCAGGGAGGGTGGGG + Intergenic
1028834730 7:95362332-95362354 CTGTGAGCTCAGAGAGGTATAGG + Intronic
1029515063 7:101018749-101018771 CTGTCAGCTCAGAGCAGGACCGG - Exonic
1031153780 7:118085307-118085329 CTGTCAGGTCAGAGAGGCATTGG - Intergenic
1032012183 7:128353875-128353897 AAGTCACCTAAGAGAGGGTGAGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033127161 7:138716540-138716562 CTGTCACATCAGAGAGCATGAGG - Intronic
1033226993 7:139570328-139570350 TGGTCAGTTCAGAGAGGGTGAGG - Exonic
1033578690 7:142711864-142711886 ATATCCGCTCAGAGAGGATGTGG - Intergenic
1033658451 7:143388407-143388429 CAGCCAGCTCAGATAGGGAGTGG - Intronic
1036594025 8:10196037-10196059 CTGTCAGAGAGGAGAGGGTGCGG + Intronic
1036633735 8:10533083-10533105 CTGGCAGTTCCCAGAGGGTGAGG - Intronic
1037176408 8:15951583-15951605 CTGTCAGCACATACAGGTTGTGG + Intergenic
1037952909 8:23030233-23030255 CTGTCAGCTGCAAGGGGGTGGGG - Intronic
1037963152 8:23114973-23114995 CTGTCAGCTGCAAGAGGGTGGGG + Intronic
1037974954 8:23202428-23202450 CTATCAGCTCCAAGAGGGTAGGG - Intronic
1038049768 8:23797524-23797546 CTATCAGCTAAAAGATGGTGAGG + Intergenic
1038925363 8:32133253-32133275 CAATCAGCTCCTAGAGGGTGAGG + Intronic
1039085646 8:33777031-33777053 CTGTGAGCTAAGAAATGGTGTGG - Intergenic
1039160267 8:34611028-34611050 CTGTAATCTCAGCGAGGCTGAGG - Intergenic
1041717308 8:60943820-60943842 CTGTAAGCTCTGTGAGGCTGGGG + Intergenic
1043910649 8:85859539-85859561 CTGTCAGCTCTTGGAGAGTGGGG - Intergenic
1044499674 8:92939315-92939337 CTGTGAGCTCACACAGAGTGGGG - Intronic
1046454604 8:114441227-114441249 GAGTCAGTTCAGAAAGGGTGTGG + Intergenic
1047576145 8:126157650-126157672 CTAGCATCTCAGAGAGGGTGAGG + Intergenic
1047976339 8:130134051-130134073 CTATAACCCCAGAGAGGGTGAGG + Intronic
1048633729 8:136272945-136272967 ATGTAAGCCCAGAGAAGGTGTGG - Intergenic
1048832415 8:138489721-138489743 GTGTGGGCTCAGAGAGAGTGTGG - Intronic
1049343059 8:142124057-142124079 CAGTGAGCTCAGAGAGGCCGAGG - Intergenic
1049377232 8:142295060-142295082 CTCTCAGCTCAGGCAGGGAGGGG + Intronic
1049462429 8:142736294-142736316 CTGTAGGCCCAGAAAGGGTGGGG - Exonic
1049756763 8:144314267-144314289 CTGTCAGCAGGGAGATGGTGGGG - Exonic
1050482060 9:6097535-6097557 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
1051064863 9:13091061-13091083 CTATCAGTTCAGAGTTGGTGTGG + Intergenic
1053476411 9:38385109-38385131 CTGTCAGCAGAGAGGGGATGTGG - Intergenic
1054959120 9:70947628-70947650 CTCAGAGCTCAGAGAAGGTGGGG + Intronic
1055480000 9:76700204-76700226 TTGGCAGCTAAGAGAGGCTGAGG + Intronic
1057227922 9:93302219-93302241 CTGTGAGCGCTGAGAGGCTGAGG + Intronic
1057363766 9:94399397-94399419 CTTTCAGCTGATAGAGTGTGAGG + Intronic
1057589904 9:96363422-96363444 CTGTCAGTTCCCTGAGGGTGAGG - Intronic
1058566375 9:106289518-106289540 TTGACAGCTGAGAGAGGCTGTGG + Intergenic
1058687402 9:107490281-107490303 CTGCGAGCGCAGAGAGGGAGGGG - Intronic
1058921959 9:109625241-109625263 CTGTCCACTAAGAGAGGGTCTGG - Intergenic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060111354 9:120909110-120909132 CTGATAACACAGAGAGGGTGGGG + Intronic
1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG + Intronic
1060554631 9:124501919-124501941 CTCTCAGCCCAGAGAGGAGGAGG - Intronic
1060662979 9:125415182-125415204 CTGTAATCCCAGAGAGGCTGAGG + Intergenic
1061280307 9:129594263-129594285 CTGTCAGCCCTGAGAGGCTTCGG - Intergenic
1061316818 9:129801596-129801618 CCGTCAGCTCTGAGAGGGCAGGG + Intergenic
1061423010 9:130482297-130482319 CTGACAGCTCCCAGAGGATGGGG - Intronic
1061491240 9:130945632-130945654 CTGTCAGTTCACTGAGGGTGTGG + Intergenic
1061512935 9:131071813-131071835 CTCTAAGCTCAGTGAGGATGGGG + Intronic
1061795090 9:133081698-133081720 CTGTAAGCTCAGCCAGTGTGAGG - Intronic
1062174335 9:135152712-135152734 GTGTCATGTCAGAGTGGGTGCGG - Intergenic
1062190721 9:135246642-135246664 CCGTTTGCTCATAGAGGGTGGGG - Intergenic
1186582596 X:10836756-10836778 CTGTAAGCTCCATGAGGGTGGGG - Intergenic
1187398026 X:18934920-18934942 GCCTCAGCTCAGAGAGGCTGTGG - Intronic
1190165022 X:48066389-48066411 CTGTCATCTCAGAGTTTGTGGGG - Intronic
1191642050 X:63436690-63436712 GTCTCAGCACAGAGAGGGAGGGG - Intergenic
1192181924 X:68921572-68921594 CTGTGAGCTCAGTGAAGGCGAGG + Intergenic
1193211559 X:78811731-78811753 CTGTCATCTCAGAAAGGGGCAGG + Intergenic
1196245782 X:113397942-113397964 TTGCCAGCTCAGGGAAGGTGTGG - Intergenic
1196812714 X:119641425-119641447 CTGTAAGCTCCTAGAGGGCGAGG - Intronic
1197161765 X:123331559-123331581 CTATCTGCTGAGTGAGGGTGAGG - Intronic
1197397207 X:125941346-125941368 CTCTCAGCAGAGAGAGGATGTGG + Intergenic
1197963289 X:132029036-132029058 CTGTTAGCTGAGAGAAGGCGGGG + Intergenic
1198838457 X:140830307-140830329 CTGGCAGGGCAGAGAGGATGGGG + Intergenic
1199722105 X:150549442-150549464 CTGAGAGCTCAGGGAGGTTGGGG + Intergenic
1199734731 X:150674952-150674974 CCATCTGCTCAGTGAGGGTGTGG + Intergenic
1200069544 X:153521199-153521221 CTGCCAGCTTAGCCAGGGTGGGG - Intronic
1200125257 X:153810445-153810467 CAGTCAGCACAGAGAGGGCAGGG + Intronic
1200700015 Y:6394141-6394163 CAGTAAGGTCAGACAGGGTGGGG - Intergenic
1201034096 Y:9770557-9770579 CAGTAAGGTCAGACAGGGTGGGG + Intergenic