ID: 1104401827

View in Genome Browser
Species Human (GRCh38)
Location 12:128482752-128482774
Sequence GAAGCTGGGGCTTTGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 10, 3: 84, 4: 631}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104401827 Original CRISPR GAAGCTGGGGCTTTGGGAAG AGG (reversed) Intronic
900116841 1:1032722-1032744 GGAGCTGGGGCTTGGGGAATGGG + Intronic
900149372 1:1171496-1171518 GAAGCTCTGACTCTGGGAAGGGG - Intergenic
900313666 1:2046781-2046803 TTAGCTGGGGTTTTGGGAAAAGG + Intergenic
900725953 1:4216445-4216467 GGACCTGGGGCTTGGAGAAGAGG + Intergenic
901295769 1:8159809-8159831 GGAGGTGGGGCCTTGGGAGGTGG - Intergenic
901874327 1:12158343-12158365 GAAAGTGGGGGTTGGGGAAGGGG + Intergenic
901883663 1:12208324-12208346 GAAGGTGGGGAGTGGGGAAGAGG - Exonic
902192609 1:14774112-14774134 GAAGTCGAGGCTTAGGGAAGAGG - Intronic
902683479 1:18060177-18060199 GAAATTGGGGCTTTGGGTGGTGG + Intergenic
902873329 1:19326916-19326938 GAAGCTGGGGAGTCGGGGAGGGG + Intronic
903462154 1:23527561-23527583 GAAACTGGGACTTGGGGAAGAGG + Intronic
903790578 1:25890212-25890234 GAAGAAGGAGCTTGGGGAAGGGG + Intronic
904260020 1:29283063-29283085 GGAGGTGGGGCTATGGGAGGTGG - Intronic
904260092 1:29283269-29283291 GGAGGTGGGGCTGTGGGAGGCGG - Intronic
904558850 1:31383526-31383548 GAAGTGGGGGCTCTGGGAACAGG + Intergenic
904651282 1:32007745-32007767 AAAGCTGAGTATTTGGGAAGTGG - Intergenic
904989511 1:34580377-34580399 TAGGCTGGGGGTGTGGGAAGTGG - Intergenic
905143665 1:35869613-35869635 GAAGTTGGGGCCTTGGGAAGCGG + Intergenic
905885168 1:41487811-41487833 AAGGCTGGGGCATTGGGATGAGG + Intergenic
906299578 1:44672399-44672421 GGAGCTGAGGTTTTGGGGAGGGG - Intronic
906476930 1:46175703-46175725 GAAGCAGAGGGTTTGGGGAGGGG - Intronic
906671799 1:47661220-47661242 GGGGCTGTGGCTTTGGGTAGAGG + Intergenic
906705169 1:47889314-47889336 AAAGCTGAGGCTTAGAGAAGTGG - Intronic
907330024 1:53664731-53664753 GAAGCTGGGGCCTGGGGGTGGGG + Intronic
907635606 1:56131779-56131801 GAAGCTGTGACCTTTGGAAGAGG + Intergenic
908431354 1:64061640-64061662 GAAGCAGGGGTTTAGAGAAGAGG + Intronic
908729981 1:67215971-67215993 GTAGCTGAGGCCTTGGGAATAGG - Intronic
908748440 1:67397450-67397472 AAAGCTGTGCCTTTGGGAACAGG - Intergenic
909474484 1:76066905-76066927 GGAACTGGGGCTTGGGGAATGGG + Intergenic
910099280 1:83559373-83559395 GAAACTGTGGCTGTAGGAAGGGG - Intergenic
910292997 1:85616727-85616749 AAAGCTGGGGCTCTGGGAAGAGG - Intergenic
910970189 1:92848389-92848411 GTAGCTGGGACTTTGAGAAACGG - Intronic
911373596 1:97024172-97024194 GCAGCCTGGGGTTTGGGAAGGGG - Intergenic
912104558 1:106255968-106255990 GAAGCTGGAGCTCAGGGAAGAGG + Intergenic
912528034 1:110299413-110299435 GCTTCTGGGGCCTTGGGAAGAGG - Intergenic
913451105 1:118993220-118993242 GAAGCTGGGCCTGGGGGAACAGG - Intergenic
914770906 1:150683981-150684003 GAAGATAGGGCTTTTAGAAGAGG + Intronic
914914755 1:151812724-151812746 TAAGGTGGGGTTGTGGGAAGTGG - Intronic
915030785 1:152878989-152879011 GAGGCTGGGCCTGTGGGCAGAGG + Intronic
915063166 1:153203404-153203426 GAAGCTGGGGGTGGGGGCAGGGG - Intergenic
915324750 1:155075640-155075662 GAGGCTAGGGCCTGGGGAAGGGG - Intergenic
915551992 1:156640790-156640812 GTAGATGGGTCTCTGGGAAGGGG + Intergenic
915928295 1:160041189-160041211 GAAGCTGGGGAAGTGGAAAGGGG + Exonic
916715433 1:167443241-167443263 GATGCTGGGGCTGGAGGAAGAGG - Intronic
916874191 1:168951198-168951220 CAAGCTGGGGCTATGGGAGCTGG + Intergenic
918452587 1:184673841-184673863 GAAGCTGGGGGCTGGGGAAATGG - Intergenic
919351328 1:196457941-196457963 GAAGATAAGGCTCTGGGAAGAGG + Intronic
919870014 1:201813128-201813150 GAAGCAAGGGCCTAGGGAAGAGG - Exonic
919902825 1:202056798-202056820 GAAGCTTGGGAAATGGGAAGTGG + Intergenic
920371300 1:205481073-205481095 GAAGATGGGGCTGGGGGAGGGGG - Intergenic
920525254 1:206661425-206661447 GAAGCTGTGGCTTTTGGTAGAGG + Intronic
921245016 1:213229096-213229118 GAAGGCAGGGCCTTGGGAAGAGG + Intronic
922498439 1:226079108-226079130 GAACCTGGGGTTTAGGAAAGAGG + Intergenic
922862355 1:228830268-228830290 GATGCAGGGCCTGTGGGAAGTGG + Intergenic
923719203 1:236452700-236452722 GAAGGTGGGGCTTGGGGCAAGGG + Intronic
923775619 1:236975771-236975793 AAACCTGGGACTTTGGGAAACGG - Intergenic
924232379 1:241972914-241972936 GAAGCTGGGGCTGGGGGTGGAGG + Intergenic
924749084 1:246868588-246868610 GAAGTTGGGCTTTTGGTAAGTGG + Intronic
1062820933 10:534130-534152 GAAGCATGGACTCTGGGAAGTGG - Intronic
1062926005 10:1315685-1315707 GATGCTGGGGCATAGGGAAGGGG - Intronic
1062988727 10:1795208-1795230 GGAGGTGGGCCTTTAGGAAGTGG + Intergenic
1063518892 10:6722982-6723004 GGAGGTGGGGCTTTTGGAAGGGG + Intergenic
1064580059 10:16784917-16784939 GGAAGTGGGGCTTTGGGAGGAGG + Intronic
1065075424 10:22074116-22074138 GTAGCTGGGGCTATGGGCATGGG + Intergenic
1065208795 10:23382407-23382429 GGAGCGGGGGGTTTGGGCAGGGG + Intergenic
1066062705 10:31738093-31738115 GAACCTCTGGCCTTGGGAAGGGG - Intergenic
1067053225 10:43037128-43037150 AAAGGTGTGGCCTTGGGAAGGGG + Intergenic
1067545260 10:47188207-47188229 GAAGTTGGGGGGTGGGGAAGAGG + Intergenic
1067831654 10:49614210-49614232 GAAGAGGGGGCTTGGGGGAGGGG + Exonic
1068946862 10:62738468-62738490 GAAGCTGTGGCTTTTTGTAGAGG + Intergenic
1069983347 10:72267707-72267729 GAAGGTGGAGCATTGGGAGGAGG - Intergenic
1069999579 10:72366315-72366337 GAAGCAGAGGCTTTGGGACCTGG + Intergenic
1070288467 10:75100046-75100068 GGAGATGGGGCTTTGGGAAGTGG + Intronic
1070746183 10:78935479-78935501 GAAGCTGCAGCTGGGGGAAGGGG - Intergenic
1072065427 10:91865055-91865077 GAAGTTGGGGTTTTGGGGGGAGG + Exonic
1072614219 10:97038711-97038733 CTCTCTGGGGCTTTGGGAAGTGG - Intronic
1073088565 10:100912809-100912831 GAAGGCGGGGCTTGGGGACGGGG - Intronic
1073571139 10:104581973-104581995 GAAGCTGAGACTTAGGAAAGAGG + Intergenic
1074685925 10:115962330-115962352 GTAGATGCGGCTTAGGGAAGAGG + Intergenic
1075089563 10:119436204-119436226 GGCAGTGGGGCTTTGGGAAGTGG - Intronic
1075161820 10:120031039-120031061 GAAGTAGGGCCTTTGGGAAGTGG + Intergenic
1075183100 10:120229732-120229754 GAACCAGGGTCTCTGGGAAGAGG - Intergenic
1075684241 10:124353079-124353101 GTAGCTGGGGGTTTGGGGGGAGG - Intergenic
1076208673 10:128623477-128623499 GAAGGTGCAGCTTTGGGAAAAGG + Intergenic
1076355303 10:129848302-129848324 GCAGCAGGTGCTCTGGGAAGGGG - Intronic
1077025412 11:437843-437865 GGAGCTGGGGTTCTGGGCAGAGG - Intronic
1077324458 11:1957733-1957755 GATGCAGGGGTTCTGGGAAGAGG - Intronic
1077413279 11:2413318-2413340 GATGCAGGGGCTGTGGGGAGTGG + Intronic
1077482003 11:2819359-2819381 CAAGCTGGGGATTTGGGAATGGG + Intronic
1077508174 11:2941670-2941692 GGACCTGGGACTTGGGGAAGGGG + Intergenic
1077663848 11:4091581-4091603 GGAGCTGGGGCTGTGAGAACGGG - Exonic
1078088519 11:8249142-8249164 GAAGCTGTGGCCTTGGGAATGGG - Intronic
1078228147 11:9412527-9412549 GAAGCTGGGGCTGGGAGCAGTGG + Intronic
1078345220 11:10541546-10541568 GAGGCTGGAGGTCTGGGAAGTGG - Intergenic
1078452137 11:11448561-11448583 GAAACTGAGGCTGAGGGAAGAGG + Intronic
1078532570 11:12148468-12148490 GAAGCTGGTGAGTTGGGAAGGGG + Intronic
1078744304 11:14096598-14096620 GAAGCTGTGGCTGCTGGAAGAGG - Intronic
1079033372 11:17002067-17002089 GTCGCTGGTGCTCTGGGAAGTGG - Intronic
1080405366 11:31973909-31973931 GAAGCTGGGGTTGGGGGAATGGG - Intronic
1080437302 11:32257051-32257073 CAAGCTTGGGTTTTGGAAAGTGG - Intergenic
1082219040 11:49610348-49610370 GAAGTGGGGGCACTGGGAAGGGG - Intergenic
1082731063 11:56798364-56798386 GAAGCAGGGCATTTGGGAAGTGG - Intergenic
1082874178 11:57971409-57971431 GTTGCTGGGGCTTAGGGGAGTGG - Intergenic
1082908778 11:58345451-58345473 GGAGCTTGGGCTCTGGGAAGAGG + Intergenic
1083889873 11:65590415-65590437 GCAGCTGGGGGTTGGGGGAGGGG - Intronic
1084177276 11:67429439-67429461 GAAGCTCTGGCTTTGGGATCAGG - Intronic
1084529181 11:69717084-69717106 CTGGCTGGGGCTTTGGGAAGAGG - Intergenic
1084584288 11:70047962-70047984 GAAGCTGGAGCATTTGGAAGCGG - Intergenic
1084673290 11:70620121-70620143 GGAGCAGGGCCTTTGGGAGGGGG - Intronic
1084722921 11:70919746-70919768 GAAGCTGGGAGGTTGGGGAGAGG - Intronic
1084899606 11:72299798-72299820 TAGGCTGGGGCTGGGGGAAGGGG + Intronic
1084974738 11:72790533-72790555 GGAGCAGGGGCTGGGGGAAGAGG - Intronic
1085119155 11:73956202-73956224 GGTGCTGGGGACTTGGGAAGGGG + Intronic
1085239056 11:75036636-75036658 GAAGCTTGGGAGGTGGGAAGGGG + Intergenic
1085527674 11:77173652-77173674 GAAGCTGGGGCCTCGGGATCTGG + Intronic
1085626177 11:78074967-78074989 GAAAATGGGGCCTTGGCAAGAGG - Intronic
1085676562 11:78525669-78525691 GGGGATGGGGGTTTGGGAAGAGG - Intronic
1085689994 11:78656857-78656879 GCAGATGGGACTTTGGGAACTGG + Exonic
1086314924 11:85581127-85581149 GAAGCTATGGCTTTAGGAAGAGG - Intronic
1086630609 11:89014526-89014548 GAAGTGGGGGCTCTGGGAAGTGG + Intronic
1087065166 11:94021260-94021282 GTAGCTTGGGTTTGGGGAAGAGG - Intergenic
1087427425 11:98008012-98008034 AAAGCTGTGGGTTGGGGAAGAGG - Intergenic
1087546333 11:99588504-99588526 GAAACTGGGACTTTGGGACAAGG + Intronic
1088685546 11:112281702-112281724 GAAGCTGTGGCGCAGGGAAGAGG - Intergenic
1088759194 11:112913167-112913189 GGAGCTGGTGGTGTGGGAAGTGG + Intergenic
1088820043 11:113448952-113448974 GAAGCCATGGCTTTGGGAGGTGG - Intronic
1089535557 11:119158763-119158785 GGTGCTGGGGCTTGGGGCAGGGG + Intronic
1089847810 11:121472013-121472035 GTAGCTGGGGCTATGGGAGCAGG - Intronic
1089884613 11:121807678-121807700 TTAGATGGGGCTGTGGGAAGTGG + Intergenic
1090157622 11:124458279-124458301 GAACCAGGGGCTGTGGGAAAAGG - Intergenic
1090434840 11:126677963-126677985 GAAGCTGGAGCCTGGGGACGGGG - Intronic
1090494287 11:127194606-127194628 GGAGCTTGGGCTTTCGGAAGGGG + Intergenic
1090972924 11:131658395-131658417 GAGGCTGGGGCAGTGGGAAAAGG - Intronic
1091301324 11:134509949-134509971 GAAGCTGGGCCTCTGTGCAGAGG + Intergenic
1202807439 11_KI270721v1_random:12910-12932 GATGCAGGGGTTCTGGGAAGAGG - Intergenic
1091388816 12:112610-112632 GAAGCTGGGGCCCAGAGAAGAGG - Intronic
1091674825 12:2481544-2481566 GGAGATGGGGCCTTGGGCAGTGG - Intronic
1092937297 12:13375990-13376012 GCAGCTGGAGCTGTGGAAAGAGG - Intronic
1093262002 12:16950260-16950282 GAAGCTGGGGTTCAGGGAGGGGG + Intergenic
1095719494 12:45385467-45385489 GAACCTTGGGCTTTGGTAAGTGG + Intronic
1095795935 12:46218776-46218798 GCAGCTAGGGGCTTGGGAAGTGG + Intronic
1096072516 12:48783173-48783195 GGAGCTGGGGCTGCGGGCAGTGG - Exonic
1096275302 12:50202193-50202215 GGAGGTGGGGCTTTGAGATGGGG - Intronic
1096439398 12:51627202-51627224 GAAACTGAGGCTTTAGAAAGAGG - Intronic
1097183712 12:57185208-57185230 GAGGCTGGGGCTCTGGGCTGGGG + Intronic
1097299830 12:58006339-58006361 GGAGGTGGGCCTTTGGAAAGTGG - Intergenic
1097442597 12:59629194-59629216 GAAGGTGGGGCCTTTGGAAGGGG - Intronic
1097538954 12:60912019-60912041 GAAGTTGGGACTTTGAGAATGGG + Intergenic
1098234986 12:68409901-68409923 GGAGCTGGAGCTTTGGGAGAGGG + Intergenic
1099247009 12:80204089-80204111 CACGCTGGGGGTATGGGAAGAGG + Intergenic
1099615140 12:84924486-84924508 GAACCTGTGGCTCTGGGAAAAGG - Intergenic
1099843131 12:87992076-87992098 GAAGCTCTGGCTCTGGGGAGAGG + Intronic
1100505181 12:95213176-95213198 TAAGATGGGCCGTTGGGAAGAGG - Intronic
1100600068 12:96105248-96105270 GGAGATGGGGCTTTGGGGAGGGG + Intergenic
1100650918 12:96587201-96587223 GAATCTGGAGTTTGGGGAAGGGG + Intronic
1101307490 12:103543649-103543671 AAAGCAGGGGCACTGGGAAGTGG - Intergenic
1101450101 12:104768207-104768229 GAAGCTGTGGCTTTGGGAGATGG + Intergenic
1101577234 12:106008866-106008888 CAACCTTGGGCTGTGGGAAGGGG - Intergenic
1102158195 12:110747151-110747173 GAAGGTGGGGATTGGAGAAGTGG + Intergenic
1102207562 12:111100930-111100952 GGAGCTGGGGCTGAGGCAAGAGG - Intronic
1103012636 12:117469050-117469072 GAAGCTGGGGCTGTCGAGAGAGG + Intronic
1103102776 12:118194315-118194337 AAAGCTGGGGCTGGAGGAAGGGG + Intronic
1104401827 12:128482752-128482774 GAAGCTGGGGCTTTGGGAAGAGG - Intronic
1105409951 13:20162959-20162981 GCAGCTGGGGCAGTGGGAAACGG + Intergenic
1106482656 13:30148480-30148502 AAAGATGGGGCTTTGGGCAGGGG + Intergenic
1106931626 13:34672038-34672060 AAAGCTGGGGGTAGGGGAAGAGG - Intergenic
1107115050 13:36738033-36738055 GAGGTTGGGGCTTAAGGAAGAGG + Intergenic
1107360577 13:39613351-39613373 GAGGCAGGGCCTTTGGGAGGTGG - Intergenic
1108259620 13:48643890-48643912 GGAGGTGGGGCTTTGGGAGGTGG - Intergenic
1108585295 13:51865624-51865646 GATCCTGGGTTTTTGGGAAGAGG + Exonic
1108705474 13:52981606-52981628 GAAGCTTTGGCATTGGGCAGAGG + Intergenic
1108746130 13:53396432-53396454 GAAAGTGGGGCTTGGGGAACTGG + Intergenic
1109540499 13:63772092-63772114 GAAGCTGGGAATATGTGAAGTGG - Intergenic
1109912549 13:68934223-68934245 GCAGGTGGGTGTTTGGGAAGTGG + Intergenic
1110531346 13:76602364-76602386 GAAGGTGAGGCTTTGCGTAGTGG - Intergenic
1110863950 13:80374260-80374282 GAAACTGGGGCTTTAAAAAGGGG - Intergenic
1111049508 13:82862227-82862249 GCACCTTGGGCTTTGGGAGGTGG - Intergenic
1112679741 13:101749923-101749945 GAAGGTGGGGCTTTGGAAGGTGG + Intronic
1112789954 13:102992249-102992271 TAAGGTGGGGCTTTGGAAGGTGG - Intergenic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1113451207 13:110411161-110411183 GAACCTGGGCCTCTGCGAAGCGG + Intronic
1113714424 13:112493076-112493098 GACGCTCTGGCTTTGGGAACGGG + Intronic
1113892411 13:113743352-113743374 GAATCTGGGGCTCTAGGGAGGGG + Intergenic
1114251861 14:20968687-20968709 GAGGCTGGGGCTGTGGGGAATGG + Intergenic
1114304776 14:21412600-21412622 GGAGGTGGGGTGTTGGGAAGGGG - Intronic
1114595515 14:23908644-23908666 GAAGCTGAGGCGTTGGGGGGTGG - Intergenic
1117357778 14:54942535-54942557 GGAGTTGGGGCTTGGGGAAGAGG - Intronic
1117777819 14:59200295-59200317 GAGGATGGGGCTTTGGGGAAAGG + Intronic
1118285966 14:64473003-64473025 AAAGCTGGGGGTTGGGGAGGGGG + Exonic
1118494106 14:66291140-66291162 GAAGCTGAGGCTTAGAGAATAGG - Intergenic
1118715669 14:68558115-68558137 CAAGCTTGGGCTTAGGGTAGTGG + Intronic
1118752967 14:68819788-68819810 GAAGCTGAGGCTCTGGGACATGG - Intergenic
1119731709 14:76955482-76955504 GCCGCAGGGGCTTTGGGAGGCGG - Intergenic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1119808504 14:77498256-77498278 GAATCTGGCGCTTTGCGGAGTGG - Intronic
1119874687 14:78048333-78048355 GATGCAGGGGCTAAGGGAAGTGG + Intergenic
1120594041 14:86412444-86412466 GGAGATGGTGCTTTGGGAAGGGG + Intergenic
1120820467 14:88907405-88907427 GAAGTTGGGCCTTTGGGGAAGGG - Intergenic
1121017682 14:90558320-90558342 GAAGCTGGGACTTTGGCCTGGGG - Intronic
1121495894 14:94391118-94391140 GGAGCTGGGGCTTTTGGAGGAGG + Intergenic
1122077143 14:99243306-99243328 GAATTAGGGGCTTTGGGAGGAGG - Intronic
1122247686 14:100415718-100415740 GGAACTGGGGCTTAGGGAACTGG + Intronic
1122343273 14:101042671-101042693 GAGGCAGTGGCTTTGGGCAGAGG + Intergenic
1122345338 14:101055120-101055142 GATAATGCGGCTTTGGGAAGCGG + Intergenic
1122349383 14:101078621-101078643 GGGGCTGGGGCTTTGGAAGGAGG - Intergenic
1122406153 14:101502272-101502294 AAAGCAGTGGCATTGGGAAGAGG + Intergenic
1122957452 14:105077329-105077351 GAAGGTGTGGCTTTGGGGTGAGG - Intergenic
1122977473 14:105176843-105176865 GAAGCTGAGGCCCTGGGAGGGGG - Intronic
1123057995 14:105581516-105581538 GAAACAGGGGTTCTGGGAAGGGG - Intergenic
1124154481 15:27213623-27213645 GATGCTGGGGCCTTGTGCAGGGG + Intronic
1124359114 15:29021798-29021820 GGAGCTGGGGGTAGGGGAAGTGG - Intronic
1124845968 15:33290333-33290355 GAAGCTGGGCATGTGGGCAGAGG - Intergenic
1126709514 15:51441573-51441595 GTAGCTTGGGGTTAGGGAAGAGG + Intergenic
1127546923 15:60000814-60000836 GGAGCTGGGGCTTTGGGGGCGGG - Intergenic
1128378642 15:67094968-67094990 GAAACTGAGGCTCAGGGAAGTGG - Intronic
1129144217 15:73633023-73633045 GACGCTGGAGCTCGGGGAAGGGG - Intronic
1131095445 15:89651816-89651838 GAAGTGAGGGCTTTGGGAAGTGG + Intronic
1131158746 15:90090836-90090858 GAGGCTGGGGCTTTGGAGAGAGG + Intronic
1132012633 15:98289467-98289489 GAAACTGAGGCACTGGGAAGTGG - Intergenic
1132100286 15:99018206-99018228 GAAGCTTGGGTTTGGGGACGGGG + Intergenic
1132314650 15:100880667-100880689 AGACCTGGGCCTTTGGGAAGCGG + Intronic
1132342131 15:101085486-101085508 CAGGCTGGGGCTCTGGGGAGAGG - Intergenic
1132366217 15:101258983-101259005 GAATCTGGGGCAGTGGGAGGAGG + Intergenic
1132655693 16:1040912-1040934 GGAGCTGGGGGTCTGGGCAGAGG - Intergenic
1132655826 16:1041327-1041349 GGAGCTGGGGGTCTGGGAGGAGG - Intergenic
1132655835 16:1041349-1041371 GGAGCTGGGGGTCTGGGAGGTGG - Intergenic
1132655868 16:1041449-1041471 GGAGCTGGGGGTCTGGGATGAGG - Intergenic
1133937131 16:10278315-10278337 GAAACTGGGGCTTGGGGAACTGG - Intergenic
1134309728 16:13064889-13064911 GAAGAGGGTGCTTTGGGGAGGGG + Intronic
1134839259 16:17388506-17388528 GAAGTTGGGGCTCAGGGAGGTGG - Intronic
1135078602 16:19414939-19414961 GAGGCTGAGGCTTAGGCAAGAGG + Intronic
1135504876 16:23027680-23027702 GGAGATGGGGGTTGGGGAAGGGG - Intergenic
1135799466 16:25479133-25479155 GAAGCTGGGGTTGGGGGAATAGG + Intergenic
1135828198 16:25749196-25749218 GAAGCTGGGGCTGTGGGGCCGGG + Intronic
1136500838 16:30669075-30669097 GGAGCTGGGGCCGTGAGAAGGGG - Exonic
1137271412 16:46904725-46904747 GAAGGTGGGGCATTGAAAAGGGG + Intronic
1137670251 16:50274428-50274450 GAAGCTGGGGCTGTGGTTGGTGG + Intronic
1138117789 16:54374149-54374171 GAAGCCGGGTCTTTGGGGAGTGG - Intergenic
1138898345 16:61237836-61237858 GGAGCTGTGGCTTAGAGAAGTGG + Intergenic
1138902989 16:61296836-61296858 GATGGTGCGGCTTTGGCAAGAGG - Intergenic
1139370879 16:66468804-66468826 GATGCTGGGGCCTTGGGAGCTGG - Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139514049 16:67443038-67443060 GTGGGTGGGGCTGTGGGAAGTGG - Intronic
1139633283 16:68243511-68243533 GAGGCAGGGGCTTTGGGAGTGGG + Intergenic
1139705120 16:68736086-68736108 GAAACTGAGGCTTTGGGAGGTGG + Intergenic
1140466358 16:75186167-75186189 GAAGCTGGAGTCTTGGGAGGAGG + Intergenic
1140886499 16:79249057-79249079 GAGACAGGGCCTTTGGGAAGTGG + Intergenic
1141590232 16:85063551-85063573 CAAGCTGGGGCTGGGGGCAGTGG - Exonic
1141700504 16:85640009-85640031 GAGGCCGGCGCTTTGGGAACAGG + Intronic
1142117925 16:88369811-88369833 GAAGCTGGGGCTGGGGGTCGCGG - Intergenic
1142539513 17:647206-647228 GAAGCAGGGGCTGAGGGCAGGGG - Intronic
1142694735 17:1627658-1627680 GGAGCTGGGGCTTTGGGAGGGGG - Intronic
1143352008 17:6295698-6295720 CAGGCTGGGGCTGAGGGAAGAGG - Intergenic
1143892635 17:10114434-10114456 GAAGCTGGGATTTAGGTAAGGGG - Intronic
1144147997 17:12416589-12416611 GGAGGTGGGGCTTTGGGAAGTGG - Intergenic
1144444721 17:15316305-15316327 GGAGGTGGGGCTTGGGGAGGTGG + Intronic
1144445313 17:15321911-15321933 GGAGGTGGGGCTTGGGGAGGTGG + Intronic
1144630760 17:16871035-16871057 GAAGATGGGGCTCCAGGAAGGGG + Intergenic
1144892328 17:18501107-18501129 GGAGCTGGGCCTGTGGGGAGCGG + Intergenic
1145139886 17:20443181-20443203 GGAGCTGGGCCTGTGGGGAGCGG - Intergenic
1145250766 17:21295775-21295797 GAAACTGAGGCTTGGTGAAGGGG + Intronic
1145810419 17:27760815-27760837 GGAGCTGGGCCTGTGGGAGGCGG + Intronic
1146309569 17:31756831-31756853 GGAGATGGGGCTTTTGGAAAGGG + Intergenic
1146459912 17:33038120-33038142 AAAGCTGGGGCTGAGGGATGGGG - Intronic
1146530340 17:33603063-33603085 GAAGATGGGGCTTCTGGAGGTGG - Intronic
1147418722 17:40311501-40311523 GAAAGTGGGGCTATGGGAATGGG - Intronic
1147441123 17:40447844-40447866 GATGCTGGGACTTAGGGAAGCGG + Intronic
1147889180 17:43704947-43704969 GAGGCTGGAGGTATGGGAAGGGG - Intergenic
1148124709 17:45230747-45230769 CAGGCTGGGGCTATGGGGAGAGG + Intronic
1148182044 17:45613146-45613168 GGAGCTGGGGCTTGGTGCAGTGG - Intergenic
1148219035 17:45849467-45849489 CAAGCTGGGGGTTGGGGAAGAGG - Intergenic
1148266816 17:46232552-46232574 GGAGCTGGGGCTTGGTGCAGTGG + Intergenic
1149558928 17:57594312-57594334 GAGGGTGGGGCTGGGGGAAGGGG + Intronic
1149864284 17:60141874-60141896 GAGGCTGGGGTTTAGGGGAGCGG - Intergenic
1150486893 17:65550291-65550313 GAAGCTGGGGGTTGGGGGAAGGG - Intronic
1151434844 17:74088775-74088797 GGAGCTGGGGCTCTGGGAGCAGG - Intergenic
1151458572 17:74241404-74241426 GAGCCGGGGGCTTTGGGGAGTGG - Intronic
1151740642 17:75979513-75979535 TTGGCTGGGGCCTTGGGAAGGGG + Intronic
1151786967 17:76279771-76279793 TAAGCTGGGCCTTTGGGACAGGG - Intronic
1151993818 17:77596140-77596162 GAAGCTGGGTTCTTGGGCAGCGG + Intergenic
1152045200 17:77930730-77930752 GAAGGTGGGGCTGGGGGAGGTGG - Intergenic
1152486737 17:80599498-80599520 GCAGCTCTGGCTTTGGGATGGGG + Intronic
1152604402 17:81281942-81281964 GAGGCTGGGGCTCAGGGCAGGGG - Intronic
1152613853 17:81329060-81329082 GAGGCTGTGGCTTTGAGGAGAGG - Intronic
1152621502 17:81367182-81367204 GAAGCCTGGGCTTGGGGAAAGGG - Intergenic
1152622466 17:81372205-81372227 GAGGCTGGGGCTGGGGGAACAGG + Intergenic
1152743914 17:82030673-82030695 GAAGCTGCGGCTCCGGGAGGCGG + Exonic
1152930763 17:83108490-83108512 GAAGCTGTTGCTTCGGGAGGAGG + Intergenic
1153393996 18:4596886-4596908 GGAGTTGAGGCTTGGGGAAGGGG - Intergenic
1154065375 18:11102525-11102547 GAGGATGGGGCTATGGGGAGAGG + Intronic
1156099895 18:33579809-33579831 GCAGCGGGGGTTTTGGGAGGGGG + Intronic
1156575621 18:38312075-38312097 AGAGCTGGGGCTTTGGGAGGCGG - Intergenic
1157449676 18:47775901-47775923 CAGGCTGTGGCTTTGGGAAAAGG - Intergenic
1157680507 18:49601891-49601913 GAGGCTGGGGGTGGGGGAAGGGG + Intergenic
1157700184 18:49757393-49757415 GCAGCAGGGGCTCTGGGAGGTGG - Intergenic
1157742894 18:50109102-50109124 GAAGCTGTGGATAGGGGAAGTGG - Intronic
1157763772 18:50282874-50282896 GAAGCTGCGGCGTGCGGAAGTGG - Exonic
1158029636 18:52947643-52947665 CCAGCTTGGACTTTGGGAAGTGG + Intronic
1158414141 18:57234496-57234518 GAAGGTGGGGAGGTGGGAAGAGG - Intergenic
1158616288 18:58990805-58990827 GAAGCTGGAGCTGTGGGAAAAGG + Intergenic
1160076319 18:75680860-75680882 GAAGCTGATGCTTTGGAAAGTGG + Intergenic
1160181559 18:76641094-76641116 GAAGCTGGGGGTTGGGGAATGGG - Intergenic
1160265795 18:77340049-77340071 GCAGGTGGGGCTCTGGGAGGGGG + Intergenic
1161124923 19:2550539-2550561 GAAGCTGGGGCTTGGTGAGGAGG - Intronic
1161290415 19:3491016-3491038 AGAGCTGGGGCTCTGGGAAGAGG - Exonic
1161537895 19:4831329-4831351 GAATCTGGGGTTTGGGGGAGGGG + Intronic
1161845454 19:6709617-6709639 GGAGCTGGGGCTGGGGGAGGTGG - Intronic
1161995047 19:7706886-7706908 GAAGCTGGAGCTTTGGGCCCAGG - Intergenic
1162001547 19:7747428-7747450 GACGCTGGGATTCTGGGAAGGGG - Intronic
1162046037 19:8001067-8001089 GAAGCTGAAGCTCTGGGAAGGGG - Intronic
1162760619 19:12886222-12886244 GACGCAGAGGCTTTGGAAAGGGG + Intronic
1163486643 19:17591476-17591498 GTAGCTGGGGCTTTGGAATGGGG + Intergenic
1163501618 19:17679835-17679857 GGAGCTGAGGCTTAGGGAAGAGG - Intronic
1163698232 19:18774662-18774684 GGGGATGGGGCCTTGGGAAGGGG + Intronic
1164739456 19:30565685-30565707 GAAGGTGGGGATGTGGGAGGGGG - Intronic
1164924525 19:32118859-32118881 GAGGCTGGGGCTGTGGGGAATGG + Intergenic
1165058417 19:33193733-33193755 GAGGCTGGGGACTTGGGAGGAGG - Intronic
1165097721 19:33418746-33418768 CATGCTGGGGCCTGGGGAAGGGG - Intronic
1165313738 19:35042529-35042551 AAAGCTGGGGCTCAGGGAAGGGG - Intronic
1165376855 19:35449089-35449111 GAAGCTGGGGCTGGGCGCAGTGG - Intronic
1165804066 19:38569728-38569750 GAAACTGAGGCTCAGGGAAGTGG - Intronic
1166521316 19:43482125-43482147 GAAACTGAGGCTTTAAGAAGAGG + Intronic
1166766066 19:45252479-45252501 GAGGTTGGGGGTTGGGGAAGGGG - Intronic
1166977280 19:46612073-46612095 GAAGCTGGGGCCCTGGAAAATGG - Intergenic
1167566993 19:50262775-50262797 GCGGCTGGGGCTTTGGGACTGGG + Intronic
1167586603 19:50378889-50378911 AGGGCAGGGGCTTTGGGAAGAGG + Intronic
1167716290 19:51144581-51144603 GGTGCTGGGGCTGTGGGATGAGG - Exonic
1167722001 19:51185614-51185636 GGTCCTGGGGCTTTGGGATGAGG - Intergenic
1167811321 19:51833796-51833818 GAGGCTGGAATTTTGGGAAGTGG + Intergenic
1167866489 19:52333021-52333043 GATACTGGGGCTGAGGGAAGAGG - Intergenic
1167959489 19:53094925-53094947 GCAGCCTGGGCTGTGGGAAGCGG - Intronic
1168642155 19:58037843-58037865 GAGGCAGGGGCTTTGGGCCGTGG - Exonic
925087758 2:1123967-1123989 GAAGCTGGGGATTGGAGAATGGG + Intronic
925178202 2:1799518-1799540 GAAGGAGGGGTTTTGGAAAGTGG + Intronic
925320183 2:2960131-2960153 GGAGGTGGGGCCTTTGGAAGGGG - Intergenic
925909961 2:8567365-8567387 GAAGCTGGAGCTTTGGGGCTGGG - Intergenic
926269931 2:11357678-11357700 AAAGCTGGGCCTCTGGGTAGAGG + Intergenic
926585833 2:14684712-14684734 AAAGCTGGTCCTTGGGGAAGAGG - Intergenic
927116163 2:19903851-19903873 GAAATTGGGGATTTGGGAAGGGG + Intergenic
927161150 2:20263245-20263267 TAAGCTGAAGGTTTGGGAAGCGG + Exonic
927393085 2:22618262-22618284 GTGGCTGGGGAGTTGGGAAGAGG + Intergenic
927509741 2:23636974-23636996 GAAGCAGTGGCTGTCGGAAGAGG + Intronic
927642358 2:24853270-24853292 CATCCTTGGGCTTTGGGAAGGGG - Intronic
927869539 2:26614815-26614837 GAAGCTGAGGCTCCGGGAAGTGG + Intronic
927927227 2:27022344-27022366 GAGGCTGGGAATATGGGAAGTGG + Intronic
928188241 2:29135463-29135485 GAAGACAGGGCTTTGGGAGGAGG - Intronic
928603106 2:32920514-32920536 GGAGAGGGGGCTTTGGGGAGGGG + Intergenic
929003180 2:37368062-37368084 GAACATGGGGCTTTGGGAAATGG + Intronic
929298461 2:40274003-40274025 GCAGCTGGGGCTGTGGAGAGAGG - Intronic
929564447 2:42975661-42975683 CGAGCTGGGGCTTGGGGAGGAGG + Intergenic
930053403 2:47234349-47234371 GGAGATGGGCCTTGGGGAAGGGG + Intergenic
930202784 2:48560775-48560797 GATGCTGGGGCCTGGGGTAGAGG - Intronic
930504161 2:52261341-52261363 GAAGCTGGGACTTTAGGGACAGG - Intergenic
930727306 2:54694739-54694761 GGAGCTAGGGCTTGGGAAAGAGG - Intergenic
931223131 2:60306288-60306310 GAAGGTGGGGCTGGGGGATGGGG - Intergenic
931749229 2:65316426-65316448 GAAGCTGAGGCTTAGAGAGGTGG - Intronic
931903977 2:66822342-66822364 ACAGCTGGGGCTTTGGCAATGGG - Intergenic
932216507 2:69969644-69969666 GCAGCTGGGGCAGTGGGGAGAGG - Intergenic
932301037 2:70667175-70667197 GAACCTGGAGCTCTGGGAATAGG + Intronic
932459415 2:71872721-71872743 GAAGCTGGGGCCTGGGGACATGG + Intergenic
934613593 2:95757948-95757970 GAGGCTGGGGCTGTGGGGTGGGG + Intergenic
934859474 2:97751925-97751947 GAAGGTGGGGCTTGGTGGAGGGG - Intergenic
935441674 2:103105161-103105183 GAAACTGTGTCTTTGGGAAACGG - Intergenic
936070728 2:109369565-109369587 GAAGCTGGGGGTTGGGGGAGAGG + Intronic
937049529 2:118876926-118876948 CAAGATGGGGCTTTAGGAAAGGG - Intergenic
937289712 2:120774919-120774941 GGAGCCCGGGCTTTGGGCAGGGG - Intronic
937346955 2:121132035-121132057 GCAGCTGGGGCTTTGGGGCCGGG + Intergenic
938727221 2:134119850-134119872 GAAGCTGGGGCGTTCCGAATTGG + Intergenic
938783215 2:134603825-134603847 GAAGGTGGGGGTGGGGGAAGGGG + Intronic
939210166 2:139164315-139164337 GAAGGTGGGGCTTTGGGCGGGGG + Intergenic
940200077 2:151140719-151140741 GAAGGTGGGACTTTGGGAAGTGG + Intergenic
940902157 2:159135554-159135576 TAAGCAGGGGCTGTGGGAACAGG + Intronic
941322401 2:164072251-164072273 GAAGCTGGGTATTTGAGACGTGG - Intergenic
941826968 2:169909488-169909510 GAAGCTGGGGCTGAGGGAGTGGG + Intronic
941934188 2:170970624-170970646 GCAGGTGGGGCTGTGGGAATTGG - Intergenic
942426012 2:175861814-175861836 GATGCTGGGGGCTGGGGAAGGGG - Intergenic
943815619 2:192250450-192250472 GAAATTTGGGCTTGGGGAAGTGG + Intergenic
943819924 2:192307691-192307713 GAAACTGGGGTTGTGGGAATGGG + Intergenic
944364680 2:198904027-198904049 GAAATTCAGGCTTTGGGAAGGGG - Intergenic
944559155 2:200917743-200917765 GAAGTTGGTGCTTTGGGAGGAGG + Intronic
944863387 2:203836782-203836804 GAAGCAAGGGATCTGGGAAGAGG + Intergenic
944924852 2:204454126-204454148 GAATCTAGGGCTGTGGGAAAAGG + Intergenic
944968563 2:204964844-204964866 GAAGGTGGGGTAGTGGGAAGGGG + Intronic
945928482 2:215830375-215830397 GAAGCTGTGTCTTTGCGAGGTGG - Intergenic
946177124 2:217928742-217928764 GCAGCTGGAGCTTTGGGGATAGG - Intronic
946305721 2:218855906-218855928 GAAGCTGGGGCCTGGTGTAGGGG + Intergenic
946379062 2:219332284-219332306 AAAATTGGGGATTTGGGAAGAGG - Intronic
946402048 2:219473280-219473302 GAAGCTCAGGCTTTGGGATCGGG + Intronic
946768992 2:223068755-223068777 AAGGCTGGGGGTGTGGGAAGAGG - Intronic
947232636 2:227903388-227903410 GAGGCTGGCACTTTTGGAAGAGG + Intronic
947384430 2:229577046-229577068 GAAGCTGGGACTGTGGGCAGTGG + Intronic
947476819 2:230457493-230457515 GAGTCTGGGGCTTTGGGAGCTGG + Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948383660 2:237568300-237568322 GAGGATGGGCCTTGGGGAAGGGG - Intergenic
948836339 2:240627888-240627910 GAAGCTGGGGCAATGGGAAGGGG + Intronic
949058965 2:241945505-241945527 GCAGGTGGGGCTTGGGGCAGAGG + Intergenic
949060940 2:241956910-241956932 GAGGCTGTGGCTCTGGGGAGCGG + Intergenic
949070290 2:242020360-242020382 GGAGCTGGAGCCTTGGGGAGGGG + Intergenic
1170778839 20:19405116-19405138 GAAGCTGGGGATTGGGGCGGGGG - Intronic
1170840016 20:19917150-19917172 GAAGCTGGGGCTTTGCCATTTGG - Intronic
1171230249 20:23478804-23478826 CAAGGTGGGCCTTTGGGAGGAGG + Intergenic
1172418871 20:34797168-34797190 GCTGCCTGGGCTTTGGGAAGAGG - Intronic
1172614683 20:36275343-36275365 GAGGCTGGGGCTCTGGAAGGAGG + Intergenic
1173146242 20:40526975-40526997 GAAGCTGTGGCTCTGGGAGGTGG - Intergenic
1173320568 20:41983618-41983640 GGAGCTGTGGCCTTGGGTAGGGG + Intergenic
1173672225 20:44806581-44806603 GAATCTGTGGGTTTGGGGAGGGG - Intronic
1173811567 20:45959141-45959163 GATGCTGGGGCTGGGAGAAGCGG + Intronic
1173906268 20:46631987-46632009 GGAGCTGGGGCAGGGGGAAGGGG - Intronic
1174643280 20:52063622-52063644 GAAACTGGGGCTTTGAGAAATGG + Intronic
1174753375 20:53134511-53134533 GAAGCTGGGCATTTGGAAAGGGG + Intronic
1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG + Intronic
1174871279 20:54185212-54185234 GAAGATGTGTCTGTGGGAAGAGG - Intergenic
1175392106 20:58633986-58634008 GTATATGGGGCTTTGGGGAGGGG - Intergenic
1175761993 20:61567518-61567540 GGAGGTGGGGCTTTTGGAAGGGG - Intronic
1175886831 20:62296954-62296976 GAGGCTTGGGTTGTGGGAAGTGG + Intergenic
1175947413 20:62565354-62565376 GAAGAAGGGTCCTTGGGAAGAGG - Intronic
1176088509 20:63308789-63308811 GAAGCTGGGGCTCAGGGACCAGG - Intronic
1176130158 20:63493436-63493458 GATGCTGGGGCTATGGGCTGGGG - Intronic
1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG + Intronic
1176289401 21:5036202-5036224 AAAGTTGGGGCGTTGGAAAGTGG + Intronic
1176374845 21:6081956-6081978 GAAGCTGAGTCTCAGGGAAGTGG + Intergenic
1177431974 21:21001064-21001086 GAAGCTATTGCTTTGGAAAGTGG + Intronic
1178419513 21:32432430-32432452 GAACCTGGAGCTTTGGCAAAGGG + Intronic
1178506660 21:33168473-33168495 GCAGCTGTGACTTAGGGAAGTGG + Exonic
1179482433 21:41686684-41686706 GAGGCAGGGCCTTTGGGAGGTGG + Intergenic
1179490142 21:41735820-41735842 TAATCTGGGGCTTGGGAAAGGGG + Intergenic
1179655567 21:42842293-42842315 GAAGCTGGGCCTCCGGGCAGGGG + Intergenic
1179748630 21:43456289-43456311 GAAGCTGAGTCTCAGGGAAGTGG - Intergenic
1179867830 21:44227385-44227407 AAAGTTGGGGCGTTGGAAAGTGG - Intronic
1180076137 21:45464043-45464065 GAGGCTGGAGCTTTGAGAACTGG + Intronic
1180763702 22:18229272-18229294 GAAGCTGGGGCATGGGGATTGGG + Intergenic
1180771942 22:18395271-18395293 GAAGCTGGGGCATGGGGATTGGG - Intergenic
1180803321 22:18644884-18644906 GAAGCTGGGGCATGGGGATTGGG - Intergenic
1181035598 22:20168456-20168478 CAAGCTGGGGCTTAGGGAAGTGG - Intergenic
1181218396 22:21350378-21350400 GAAGCTGGGGCATGGGGATTGGG + Intergenic
1181671270 22:24426619-24426641 GAACCTGGGGCTCTGGGTGGTGG + Intronic
1181688497 22:24545071-24545093 GCAGATGGGGCTGTGGGCAGGGG + Intronic
1182020438 22:27077092-27077114 GAAACTGAGGCTTTGGGAGAGGG - Intergenic
1182113551 22:27741941-27741963 GAAGAGGGGGCTTTTGGATGTGG - Intergenic
1183353081 22:37344396-37344418 GATGCTGGGGGTTTGGGATGGGG - Intergenic
1183354630 22:37351558-37351580 GACGCTGGAGCATGGGGAAGGGG - Intergenic
1183451612 22:37899014-37899036 GGAGCTGGGGCCTGGGGCAGTGG - Intergenic
1183490203 22:38111825-38111847 GAGGCTGGGGCTGGGGGCAGGGG + Exonic
1183574961 22:38682175-38682197 GAAGCGGCTGCTTTGGGAGGCGG + Intronic
1184337828 22:43864879-43864901 TAACCTGGGGCATTGGAAAGAGG + Intergenic
1184408110 22:44311630-44311652 GAAGCTGAGGCCTGGGGAAAGGG + Intronic
1184447298 22:44556413-44556435 GAAGCTGGGGGATGGGGAGGAGG - Intergenic
1184854180 22:47137544-47137566 GAATGTGGGGCTTTGGGCAGAGG - Intronic
1184931862 22:47687285-47687307 CAAGCTGGGGCTGTGGGACTAGG + Intergenic
1185299125 22:50070365-50070387 GAAGGTGGGGTTGTGGGAGGTGG - Intronic
1185389291 22:50550017-50550039 GAGGCCGGGGCTCAGGGAAGGGG + Exonic
1203233780 22_KI270731v1_random:136261-136283 GAAGCTGGGGCATGGGGATTGGG - Intergenic
949859762 3:8494577-8494599 GGAGCTGTGGCTTTAGGTAGGGG + Intergenic
949948292 3:9207714-9207736 GTAGCCGGGCCTTTGGGAAGGGG + Intronic
950026082 3:9820753-9820775 GCAGCTGGGACTTTGGGCTGTGG + Intronic
950111858 3:10423801-10423823 GAAACTGAGGCTCAGGGAAGGGG - Intronic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
950499688 3:13355754-13355776 GAAGCCGGGAGTTTGGGCAGGGG + Intronic
950628648 3:14267006-14267028 GTTGCTGGGGCTTTGAGGAGTGG + Intergenic
951541467 3:23786246-23786268 GATGCTGGGATTTTAGGAAGGGG - Intergenic
951874647 3:27408862-27408884 GAAACTGTGGCTTTTTGAAGTGG - Intronic
952115082 3:30169141-30169163 GAAGTAGGGGATTTGGGTAGTGG + Intergenic
952639721 3:35579289-35579311 GAAGCCTGGGTTTAGGGAAGGGG - Intergenic
952869512 3:37886008-37886030 GAAGCTGTGGCAGTGGGAAATGG - Intronic
953657793 3:44867095-44867117 GAAACTAAGGCTTGGGGAAGTGG + Intronic
953718261 3:45334091-45334113 GATTCTGGGGCCCTGGGAAGTGG + Intergenic
954179197 3:48868199-48868221 GAAGGTGGGGGGTTGAGAAGAGG + Intronic
954361639 3:50125491-50125513 GAACACGGGGCTTTGGGAAGGGG + Intergenic
954632036 3:52052920-52052942 GAAGCTGAGGCCTGGGGGAGGGG - Intronic
954818880 3:53307322-53307344 AAATCTGGGGCTTGGGGCAGTGG - Intronic
955551407 3:60089012-60089034 GAAGCTGGGGCTTACAGAAATGG + Intronic
955756983 3:62234979-62235001 TAATCTGGGGCTTAGTGAAGAGG + Intronic
956611622 3:71129626-71129648 GAAGTTGGGGGTCAGGGAAGGGG + Intronic
960587852 3:119336798-119336820 GAAGGTGGGGCAATGGGAAATGG - Intronic
961028829 3:123584848-123584870 GAGGCTGGGGCTCGGGGAGGCGG - Intronic
961165435 3:124760265-124760287 GAAGCTGGGGGTTTGTCCAGTGG - Intergenic
961884447 3:130086957-130086979 GAACCTGGAGCTTTGGCAAAGGG - Intronic
962208463 3:133455718-133455740 GATGGTGGGGGTTTGGGGAGGGG - Intronic
963315198 3:143751557-143751579 TCAGCTGGGGCTTTGGTGAGGGG + Intronic
964606536 3:158566042-158566064 GAAGCTGGGGCTCTGGGCCCTGG - Intergenic
965757726 3:172041520-172041542 GGAGGTGGGGCGTTGGGAATGGG + Intronic
968269833 3:197394883-197394905 AAAGCTGAGGTTTTGGGAACAGG + Intergenic
968463536 4:737856-737878 GAAGCTGGCGCTGTGGGATGAGG - Intronic
968573373 4:1353942-1353964 GAAGCTGGGGCTGGGGGGCGGGG - Intronic
968665064 4:1816487-1816509 GGAGAGGGGGCTGTGGGAAGAGG + Intronic
968939319 4:3629895-3629917 GGAGCTAGGGGTGTGGGAAGGGG + Intergenic
969101175 4:4769295-4769317 GAAACTGAGGCTTTGGGAGATGG + Intergenic
969120223 4:4903068-4903090 GGAGCTGGGGGATTGGGAAGGGG + Intergenic
969354090 4:6614974-6614996 GCAGCTGGGGCTCTGGCAACAGG - Intronic
969479615 4:7441005-7441027 GAAGGTGGAGATTTGGGGAGAGG + Intronic
969689128 4:8694616-8694638 CAAGGTGGTGCTTTGGGAAAGGG + Intergenic
969820331 4:9715326-9715348 GAACCTGGAGCTTTGGCAAAGGG + Intergenic
969977259 4:11116378-11116400 AGAGCTGGGGCTTTGGGAGTGGG - Intergenic
970644005 4:18098571-18098593 GAGGGTTGGGCTGTGGGAAGGGG + Intergenic
971749691 4:30631579-30631601 GAAGCTGTTGCTTTGGACAGTGG - Intergenic
973346393 4:49060334-49060356 GAATCTGGGGCTTTTGGGGGTGG + Intronic
973635065 4:52854460-52854482 GGAGCTGATGCTTTGGGGAGAGG + Intergenic
973886689 4:55329271-55329293 GAAGCTTGGACTTTGGGAAGGGG - Intergenic
973924710 4:55725788-55725810 AAAGCTGTGGCTTTTGGACGAGG - Intergenic
974542066 4:63250331-63250353 GTAGCTGGAGATCTGGGAAGGGG - Intergenic
974728208 4:65824604-65824626 GAATATTGGGCTTTGGGAATTGG - Intergenic
975393784 4:73852272-73852294 GAACCTTGGGCTTTGGGTTGAGG + Intergenic
976828594 4:89287471-89287493 AAAGCTGAGCCTTTGGGCAGAGG + Intronic
977749092 4:100587203-100587225 GATGCTGGAGGTTTGAGAAGGGG + Intronic
978498725 4:109386375-109386397 GGGGCTGGGGGTCTGGGAAGGGG + Intergenic
978718190 4:111871922-111871944 GAAGCTGGGGATTTGATAGGTGG - Intergenic
979714756 4:123823950-123823972 GAAACTGGGGCTGGGGGCAGGGG - Intergenic
981050464 4:140304706-140304728 GAAGGCTGGTCTTTGGGAAGGGG + Intronic
981536521 4:145805948-145805970 GAAAGAGGGGGTTTGGGAAGGGG - Intronic
984166570 4:176309534-176309556 GGTTTTGGGGCTTTGGGAAGAGG - Intergenic
984398680 4:179233131-179233153 GCAGCTGTGGCTGGGGGAAGAGG - Intergenic
985620384 5:951997-952019 GGAGCGGGGCCTGTGGGAAGGGG - Intergenic
986107255 5:4671589-4671611 GAACCTGGGGCTTTGTTCAGGGG - Intergenic
986293547 5:6419051-6419073 GAATCCTGGGCTATGGGAAGGGG - Intergenic
986983167 5:13472469-13472491 GTTGCTGGGGCTGTGGGGAGGGG + Intergenic
987000729 5:13656797-13656819 GAAACTGGGGATTGGAGAAGTGG - Intergenic
987204798 5:15614025-15614047 GGAGGTGGGGCCTTGGGAGGTGG - Intronic
987942586 5:24560980-24561002 GAAACTGAAGCTTAGGGAAGTGG - Intronic
988257298 5:28837020-28837042 GAATCTGAGGCTGTGTGAAGTGG - Intergenic
988785159 5:34560005-34560027 GAAGTTGGCACTTTGGGAGGCGG - Intergenic
989154690 5:38332960-38332982 GACGCTGGGGTGTTGGGAACAGG - Intronic
989795571 5:45467205-45467227 GAAGTTGCGTCTTTGGGGAGGGG - Intronic
989813965 5:45712774-45712796 GAAGCTTGGGGTTTGTGAACTGG - Intergenic
990149322 5:52799326-52799348 AAAGCCGAGGCTATGGGAAGTGG - Intronic
990516317 5:56534190-56534212 TAGCCTAGGGCTTTGGGAAGGGG - Intronic
990990408 5:61678287-61678309 GAAGGTGGGGGTATGGTAAGAGG - Intronic
991277921 5:64872857-64872879 AAATGTGGGGGTTTGGGAAGAGG - Intronic
991516742 5:67444690-67444712 GAAGCTGGTGTTTAAGGAAGTGG - Intergenic
991550850 5:67834287-67834309 GTAGATGGGGCTTGGGGAAATGG - Intergenic
991663545 5:68974137-68974159 GAAGCTTGGGGTTAGGGGAGGGG - Intergenic
991943281 5:71875797-71875819 GAAGTAGGGCCTTTGGGAGGAGG + Intergenic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
992863002 5:80930841-80930863 GAAGGTAGGGCCTTGGGGAGAGG - Intergenic
993573398 5:89570490-89570512 GAAGCTTGGGTTTTAGGAAATGG - Intergenic
994034657 5:95184930-95184952 GCAGATAGGGCCTTGGGAAGTGG - Intronic
994573691 5:101547953-101547975 GAGGCTGGGGATTGGAGAAGAGG + Intergenic
994659893 5:102641291-102641313 GCTGCTGGGGGTTGGGGAAGGGG - Intergenic
995400243 5:111733031-111733053 AGAGCTAGGGATTTGGGAAGAGG + Intronic
995486972 5:112649027-112649049 TGAGCTGAGGCTTTGGGAATGGG - Intergenic
996536240 5:124581004-124581026 GAAGCTGAGCTTTGGGGAAGGGG - Intergenic
997201530 5:132012655-132012677 CAAGCAAGGGCATTGGGAAGAGG - Intergenic
997453164 5:133999641-133999663 GGAGCTGTGGCCTTGGGTAGAGG - Intronic
997750084 5:136335992-136336014 GAAGTTGGGTTTGTGGGAAGGGG - Intronic
997839265 5:137224087-137224109 GAGGCTGGTTCTTTGGAAAGAGG + Intronic
998412700 5:141923607-141923629 GAAGCGGGACCTTCGGGAAGTGG - Intergenic
998477776 5:142436015-142436037 GAAGCTGGGGCTGGGTGAAGTGG - Intergenic
999222952 5:149996784-149996806 GAAACTGGGGCCCTGGGAAGGGG + Intronic
999248533 5:150167921-150167943 GAAGCGGGAGCAGTGGGAAGGGG + Intronic
999754318 5:154653281-154653303 GAAACTGAGGCTTAGGGACGTGG + Intergenic
1000014441 5:157265538-157265560 GCAACTGGGGCTAGGGGAAGGGG - Intergenic
1000138631 5:158380212-158380234 GATGGTGGGGCTTGGGGTAGTGG + Intergenic
1000335293 5:160237585-160237607 GAGGCTGGGGCTTGGTGTAGGGG - Intronic
1001426872 5:171628653-171628675 CAACATGGGGGTTTGGGAAGAGG - Intergenic
1002189170 5:177469908-177469930 GAGGCTGGGGCTGTGAGGAGGGG + Intronic
1002381597 5:178833259-178833281 GAAGCTGGAGCGGTAGGAAGGGG + Intergenic
1002442349 5:179270989-179271011 GAAGGTGGGGGTTTGGTAATGGG - Intronic
1002525796 5:179815599-179815621 GAAGCAGGAGCCTTGGGGAGGGG - Intronic
1002607477 5:180391626-180391648 GAGGCTGGGGGTTTGGTAAGGGG - Intergenic
1002769757 6:280994-281016 AAAGATGGGCCTTGGGGAAGGGG - Intergenic
1002858592 6:1059398-1059420 GTTGCTGGGGCTTGGGGGAGGGG + Intergenic
1003287041 6:4743507-4743529 GAAGATGTGGCTGGGGGAAGGGG - Intronic
1003879065 6:10463972-10463994 GGATCACGGGCTTTGGGAAGAGG + Intergenic
1003981403 6:11393641-11393663 CAAAATGAGGCTTTGGGAAGGGG + Intergenic
1003994281 6:11523200-11523222 GAGGCTGGAGCTTAGGGGAGAGG + Intergenic
1004855901 6:19749572-19749594 GAAACTGGGGATTTGAAAAGAGG - Intergenic
1005401549 6:25439317-25439339 GAGGCTGGGGCTTGGAGGAGAGG + Intronic
1005872614 6:29986154-29986176 GGAGCTGGGGCTGAGGTAAGAGG + Intergenic
1006013447 6:31061732-31061754 GAAATTGGGGATTTGGGAAATGG - Intergenic
1006033468 6:31194617-31194639 GGAGCTGGGGCTGAGGTAAGAGG - Intergenic
1006072508 6:31507647-31507669 GAAGCTGGGGTATTTGGGAGGGG + Intronic
1006170494 6:32089197-32089219 AGAGCTGGGGCTGTGGGGAGGGG - Intronic
1006188751 6:32195250-32195272 GAAGCTGCAGCTCTGGAAAGAGG - Exonic
1006455358 6:34128849-34128871 GAAGCTAAGGCTTGGAGAAGGGG - Intronic
1007126128 6:39427105-39427127 GAAGCTGAGGCTTAGAGATGAGG + Intronic
1007290623 6:40783474-40783496 GCAGCTGTGGCCTTGGGAAGAGG + Intergenic
1007336040 6:41155834-41155856 TAAGCTGGGCCTTGTGGAAGTGG + Intergenic
1007418419 6:41705529-41705551 GAAGCTGTGTCGTTGGGAAGAGG - Intronic
1007714663 6:43848728-43848750 GAAACTGAGGCCTTGGGAGGGGG + Intergenic
1007721374 6:43887363-43887385 GAAGCTGTGGGCTTGGCAAGAGG - Intergenic
1007753026 6:44081489-44081511 GAAGCCGGGGCTTCTGGGAGTGG - Intergenic
1007971443 6:46055913-46055935 TTGGCTGGGGCTATGGGAAGAGG + Intronic
1008118382 6:47580505-47580527 GCAGCTGGGGTTGTGGGGAGAGG - Intronic
1008536570 6:52510507-52510529 GAAGATGGTGCCTTGGGAGGTGG + Intronic
1010864862 6:80963156-80963178 TAAGCTTGGGCATTGAGAAGTGG - Intergenic
1011913493 6:92472021-92472043 GAAGAAGGGGGTTTGGGATGAGG + Intergenic
1012560319 6:100572161-100572183 GAAGTGGGGGCTTTGGGGAGGGG + Intronic
1012852661 6:104465678-104465700 GAAACTGAGGCTTGGGGAAGTGG - Intergenic
1013047872 6:106505561-106505583 GAAGATGGGGAATGGGGAAGGGG - Intergenic
1013366804 6:109443203-109443225 GGAGCTGGTTCTCTGGGAAGAGG + Intronic
1013572008 6:111437671-111437693 GTTGCTGGGGCTTAGGGAATTGG + Intronic
1014109715 6:117607034-117607056 AAACCTGGAGCTGTGGGAAGTGG - Intergenic
1015210244 6:130688841-130688863 GAGGCTGGGGGTTGGGGAATAGG - Intergenic
1015601838 6:134917890-134917912 GTAGCTGGGGCTATAGGCAGAGG + Exonic
1016208240 6:141496697-141496719 GCAGCTGGGGGTTGGGGAACAGG - Intergenic
1017259050 6:152365845-152365867 GAAGCTGAGGCTTTGGAAGTTGG - Intronic
1017690324 6:156957501-156957523 GAAGCTGGAGCTTTAGGATATGG + Intronic
1017962027 6:159231950-159231972 GAAGCTGGAGCTCTGGGAGAAGG - Exonic
1018668086 6:166158134-166158156 GATGCTGGGGCTCTGGGGAAAGG + Exonic
1018788972 6:167131553-167131575 GGAGCAGGGGCTGTGGGGAGCGG - Intronic
1018885473 6:167931938-167931960 GAAACTGAGGCTTTGAGAGGGGG - Intronic
1019533319 7:1514528-1514550 GAAACTGAGGCTTAGAGAAGGGG - Intergenic
1019751348 7:2732296-2732318 AATCCTGGTGCTTTGGGAAGTGG + Intronic
1019878590 7:3838444-3838466 TCAGCTGAGGCATTGGGAAGAGG + Intronic
1020379806 7:7531089-7531111 GATGCTGAGGATTTTGGAAGGGG - Intronic
1023026708 7:36057459-36057481 GAATCTGGAGCTTGGGAAAGAGG - Intergenic
1023065257 7:36371212-36371234 GAGGCTGAGGCTTAGGTAAGAGG - Intronic
1023150129 7:37194302-37194324 GGAGATGCAGCTTTGGGAAGGGG - Intronic
1023921326 7:44632403-44632425 GAAGCTGAGGCGTGGGGGAGTGG - Intronic
1024939413 7:54746489-54746511 GAGGGTGGAGCTGTGGGAAGAGG - Intergenic
1025871975 7:65443130-65443152 GAGGCTGGGGTTTGGGGAAATGG - Intergenic
1026589576 7:71683313-71683335 GAAGGAGTGGGTTTGGGAAGTGG - Intronic
1026866508 7:73827542-73827564 GATCTTCGGGCTTTGGGAAGAGG + Intronic
1026990113 7:74580250-74580272 GGAGTTGGGGCTCTGTGAAGTGG + Intronic
1027374964 7:77538867-77538889 GGAAGTGGGACTTTGGGAAGTGG + Intronic
1027888328 7:83937854-83937876 AAAGCTGGGGTTTTAGTAAGTGG - Intergenic
1028240596 7:88415338-88415360 CAAGCTGTGGCTTTGGGTAGAGG - Intergenic
1028455147 7:91030525-91030547 GAATATGGGGCTCTTGGAAGAGG - Intronic
1028522088 7:91742706-91742728 TGAGCTGGGGTTTTGGGGAGGGG + Intronic
1029153116 7:98495356-98495378 GAAGCTGGGCCTCTGGGCTGGGG + Intergenic
1029702129 7:102254145-102254167 GCTGCTGGAGCTTTGGGAACAGG - Exonic
1031045636 7:116884415-116884437 GAAGCTGAGGGGTGGGGAAGGGG - Intronic
1032021295 7:128408447-128408469 CAACCTGGAGCTGTGGGAAGAGG - Intronic
1032451406 7:132035017-132035039 GAAGCTTAGGCTCTGGGAAGAGG + Intergenic
1032699206 7:134363990-134364012 GAAGCTGTGGTCTTGGGTAGAGG - Intergenic
1032805737 7:135352558-135352580 GGAGTTGAGGCTTTGGGAGGGGG - Intergenic
1032839154 7:135700465-135700487 GAAGATGGGGCAGTGGGAAAGGG - Intronic
1033093343 7:138407051-138407073 GAAACTGAGGCTTGGGGAACTGG - Intergenic
1034032603 7:147784899-147784921 GATGCAGTGGCTGTGGGAAGAGG + Intronic
1034421523 7:150993485-150993507 GGGGCTGGGGCATTGGGGAGTGG - Intronic
1035389641 7:158496489-158496511 GAAGGTGGGGCGCAGGGAAGGGG - Intronic
1035396918 7:158540647-158540669 GACCCTGGGGCTTCGGGCAGGGG + Intronic
1035469443 7:159100252-159100274 GAAGCTGAGGCTTAGGGGAGTGG - Intronic
1035484624 7:159212995-159213017 GAAGCTGTGGCTCTGGGCAGGGG + Intergenic
1035730997 8:1853543-1853565 GAAGCTGGGGTTTTGAGAAGCGG + Intronic
1037074825 8:14701756-14701778 GAGGCAGGGGGTTTGGTAAGAGG - Intronic
1037199346 8:16232741-16232763 CGAGGTGGGGCTTTGGGAGGTGG - Intronic
1037652432 8:20851016-20851038 GCAGCTGGGGACTTGGGCAGAGG + Intergenic
1037765387 8:21769312-21769334 GTATCTGGGGCATTGAGAAGGGG - Intronic
1038319229 8:26513070-26513092 AAAGCTGGAGATTTGGGAAGGGG + Intronic
1038326201 8:26574546-26574568 GAAAGTGGAGGTTTGGGAAGGGG + Intronic
1038488103 8:27950541-27950563 AAAGCTGAGGCTTTGGGGAAGGG + Intronic
1038534610 8:28344804-28344826 GAAGCAGGAGCTATAGGAAGAGG - Intergenic
1039399890 8:37260759-37260781 AAACCTGGAGCTTTGGCAAGGGG + Intergenic
1039468980 8:37802124-37802146 GAAGATGGGCCTCAGGGAAGTGG + Intronic
1039758664 8:40550230-40550252 AAAGCAGGGCCTTTGGGAGGTGG - Intronic
1039885693 8:41652959-41652981 GAAGTTGGGGGTCTGGGGAGGGG - Intergenic
1040324678 8:46335698-46335720 GAAGCCCAGGCTTTGGAAAGGGG + Intergenic
1040409703 8:47141840-47141862 AAAGCTGGGGGTGTGGGAAGGGG - Intergenic
1041244646 8:55879274-55879296 GAAACTGAGGCTTTGAGAAACGG + Intergenic
1041412809 8:57575250-57575272 GCAGCTTGGTGTTTGGGAAGAGG + Intergenic
1041672303 8:60504003-60504025 GAATCTGGAGCTTGGGGGAGTGG - Intergenic
1044023268 8:87134286-87134308 GAAGCTGTGACTTTGGAAAAGGG + Intronic
1045543572 8:103108610-103108632 GAAGGTGGAGCTTTCGTAAGTGG - Intergenic
1046160199 8:110352630-110352652 GAAGATGGTGATTTGGCAAGGGG + Intergenic
1046583242 8:116119625-116119647 GTGGCAGGGGCTTGGGGAAGAGG - Intergenic
1047705645 8:127496880-127496902 TAAGGTATGGCTTTGGGAAGAGG + Intergenic
1048047536 8:130786914-130786936 GAAGCTAGGGGCATGGGAAGGGG + Intronic
1048048617 8:130796369-130796391 GAGGCAGGGGCTGTGGGATGAGG + Intronic
1048574085 8:135677546-135677568 GGAGCTGTACCTTTGGGAAGAGG - Intergenic
1049272296 8:141702437-141702459 GACGCAGGGGCTTGGGGAAGGGG - Intergenic
1049323333 8:142009118-142009140 GCAGGTGGGGCTTCGGGAAGGGG + Intergenic
1049793447 8:144484173-144484195 CTAGGTGGGGCTGTGGGAAGGGG - Intronic
1052828885 9:33198716-33198738 GAATTTGGGGCTTAGGAAAGAGG + Intergenic
1052879717 9:33594061-33594083 GAAGGTGGGGCCTAGGGGAGGGG + Intergenic
1052969814 9:34370625-34370647 GAAGGTGGGGCCTAGGGAGGGGG - Exonic
1053142148 9:35689095-35689117 GGAGTTAGGGCTCTGGGAAGGGG - Intronic
1053496262 9:38550168-38550190 GAAGGTGGGGCCTAGGGGAGGGG - Intronic
1053602831 9:39628023-39628045 AAATCTGGTGCTTTGGGAAGAGG - Intergenic
1053654492 9:40202451-40202473 TAAGCTGTTGCTTTTGGAAGGGG + Intergenic
1053860478 9:42381769-42381791 AAATCTGGTGCTTTGGGAAGAGG - Intergenic
1053904885 9:42831665-42831687 TAAGCTGTTGCTTTTGGAAGGGG + Intergenic
1054250706 9:62714413-62714435 AAATCTGGTGCTTTGGGAAGAGG + Intergenic
1054366607 9:64348668-64348690 TAAGCTGTTGCTTTTGGAAGGGG + Intergenic
1054451439 9:65405429-65405451 GGAGCTAGGGGTGTGGGAAGGGG - Intergenic
1054530102 9:66173858-66173880 TAAGCTGTTGCTTTTGGAAGGGG - Intergenic
1054564815 9:66748925-66748947 AAATCTGGTGCTTTGGGAAAAGG + Intergenic
1054674236 9:67838412-67838434 TAAGCTGTTGCTTTTGGAAGGGG + Intergenic
1055020581 9:71665036-71665058 GAAGCCAGTGCTGTGGGAAGAGG - Intergenic
1055087683 9:72330799-72330821 GATGCTGGGGCTATGGGACCTGG - Intergenic
1055470680 9:76607536-76607558 GAAGGTGGGGGATTGGGATGAGG + Intergenic
1055686412 9:78779765-78779787 CAAGCTAGGGCTTAGGAAAGAGG - Intergenic
1056280807 9:85039660-85039682 GAAGCTGGGGGTTGGGGGTGGGG - Intergenic
1056425723 9:86474496-86474518 GGGGCTGGGGCTTGGGGAAATGG + Intergenic
1057197229 9:93121801-93121823 GACGCTGGTGCTTTGGGAGAGGG + Exonic
1057785636 9:98085500-98085522 GCAGCTGTGGGTCTGGGAAGAGG + Exonic
1057855049 9:98595307-98595329 GAGGTAGGGCCTTTGGGAAGGGG - Intronic
1058985345 9:110204763-110204785 GAGGCTGGGGCATGGGGAAGTGG - Intronic
1060290793 9:122300687-122300709 GAACATGGGGCTTCAGGAAGGGG - Intronic
1060422614 9:123480196-123480218 GAAGCAGGGGCCCTGGGAGGAGG - Intronic
1060918112 9:127403230-127403252 GAAGGCGGGGCTTAGGGAGGAGG + Intronic
1061379675 9:130246871-130246893 CGAGCTGGTGCTTTAGGAAGTGG + Intergenic
1061406291 9:130394600-130394622 GAGGCTGGGGGTTGGGGGAGAGG + Intronic
1061433570 9:130546512-130546534 GAAGCTTGGGGCTTGGGGAGAGG + Intergenic
1061817990 9:133207702-133207724 GAAGCTGAGGGTTAGGGATGAGG - Intronic
1062048489 9:134435358-134435380 AAGTCTGGGGCTCTGGGAAGAGG - Intronic
1062159056 9:135069663-135069685 GGAGTTGGGGCTGTGGGCAGGGG + Intergenic
1062531311 9:137001856-137001878 GAAGCGGGGTCTTTTGGAGGTGG + Intergenic
1186209774 X:7237828-7237850 GAAGATGGGAGTGTGGGAAGGGG - Intronic
1186603849 X:11067948-11067970 GTTGCTGGGGCTTGGGGAGGGGG + Intergenic
1186782194 X:12924325-12924347 GAAGAGTGGGCTTTGGAAAGTGG + Intergenic
1187193700 X:17060629-17060651 GAAGCTTAGGTTCTGGGAAGGGG + Intronic
1187562433 X:20415259-20415281 GAAGCTGAGTCACTGGGAAGAGG - Intergenic
1188371000 X:29369478-29369500 GGAGCCTGGGCTTTGGGGAGTGG - Intronic
1188531278 X:31144152-31144174 GAACCTGGAGCAGTGGGAAGAGG - Intronic
1189102965 X:38210164-38210186 CAAGCTGGGTATGTGGGAAGTGG - Intronic
1189130751 X:38495581-38495603 GGAGCTGGGGCTATGGGAAAGGG - Intronic
1189213112 X:39301312-39301334 GGAGCTGGGGCCTTAGGTAGAGG + Intergenic
1190058563 X:47196337-47196359 GAAGCTAGGGCATAGAGAAGGGG - Intronic
1190712710 X:53081656-53081678 GAAGCGGGGGATGGGGGAAGGGG + Intergenic
1192151238 X:68713803-68713825 GAATCTGGAGCTTGGGGATGAGG - Intronic
1193650139 X:84122177-84122199 GCTGCTGGGGCATGGGGAAGGGG - Intronic
1193698783 X:84739682-84739704 TCAGCTGGGGCTGTGGGGAGGGG - Intergenic
1194375373 X:93126137-93126159 GAAGCTTGGGCCATGGGGAGAGG - Intergenic
1194399004 X:93420249-93420271 GCTGGTAGGGCTTTGGGAAGAGG - Intergenic
1195961833 X:110394974-110394996 GCAGCTGGAGCTTTGGGATCTGG + Intronic
1196494475 X:116307788-116307810 GCTGCTGGGGTTTTGGGGAGAGG + Intergenic
1196557057 X:117100651-117100673 GAAGCTGGGGCCTTGGGGACTGG - Intergenic
1198551454 X:137749533-137749555 TAAGCTGGGGATTTGGGTGGGGG + Intergenic
1198666218 X:139026080-139026102 GAAGTTGGGGCAATGGGAATTGG - Intronic
1198768148 X:140099290-140099312 GAAACTGGGACTGGGGGAAGAGG - Intergenic
1198782661 X:140254723-140254745 TAAGCTGAGGCTTTGGTAATTGG + Intergenic
1199862703 X:151816152-151816174 GATGCTGGGAATTTGGGGAGGGG + Intergenic
1199938624 X:152602184-152602206 GAAACTGAGGCTCTGAGAAGTGG + Intergenic
1200977720 Y:9229988-9230010 GAAGTTGGGTATTAGGGAAGGGG - Intergenic
1202584662 Y:26409959-26409981 GGAGCCGGGGCTGCGGGAAGAGG + Intergenic