ID: 1104405275

View in Genome Browser
Species Human (GRCh38)
Location 12:128511656-128511678
Sequence CCTTGGGGTCCTGTCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104405269_1104405275 9 Left 1104405269 12:128511624-128511646 CCTGGAGCATTACAACGAGATGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG 0: 1
1: 0
2: 3
3: 27
4: 244
1104405268_1104405275 26 Left 1104405268 12:128511607-128511629 CCTTGTATCACAACACACCTGGA 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG 0: 1
1: 0
2: 3
3: 27
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104405275 Original CRISPR CCTTGGGGTCCTGTCTCTCC TGG Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900579888 1:3403654-3403676 CCTTGGGGACCTGTGGCCCCCGG + Intronic
900646940 1:3713288-3713310 GCTTGGGGACCGGCCTCTCCTGG + Intronic
900950448 1:5855581-5855603 CCATAGGGTCCTGTCTCTGCAGG - Intergenic
902229934 1:15021521-15021543 CCTTGGCCTCCTGTCTCCCTCGG + Intronic
902573780 1:17363765-17363787 CCCTGGCGTCCTCTCCCTCCTGG + Exonic
903522432 1:23960727-23960749 CCTTGAGATCCAGTCACTCCTGG - Intronic
904542025 1:31239683-31239705 CCTTGGGGACCGGACACTCCCGG - Intergenic
904604141 1:31689769-31689791 CCTTTGGGCCCTGGCTTTCCAGG + Exonic
904696511 1:32334719-32334741 CCTGGGGTTCCTGGCTCTCAGGG + Exonic
906720201 1:47998487-47998509 CCTTGTGCTTCTGTCTCTCCTGG - Intergenic
907447796 1:54520066-54520088 CCTGGGGGTCCTCCATCTCCTGG + Intergenic
910051962 1:82985271-82985293 CCTTGGGTTCCTGTCCCTAATGG + Intergenic
911052331 1:93681549-93681571 CCTCGGGGTGCTGTTCCTCCCGG - Intronic
914901265 1:151712389-151712411 GCCTGGGGTCCTGCCACTCCTGG + Intronic
915259114 1:154663217-154663239 CCTTTGAGTCCTGACTCTCCTGG + Intergenic
915361233 1:155287519-155287541 GCTTGGGATGCTATCTCTCCTGG - Intronic
919879331 1:201891709-201891731 CCTATGGGTCCTGTCTGCCCCGG + Intronic
920367684 1:205456671-205456693 CCTTCGGGTCCTGCCGCCCCCGG + Intergenic
920786775 1:209050031-209050053 CCTTGGCTCCCTGTCTCTCCTGG - Intergenic
922594337 1:226802540-226802562 CCTTGGGGTCCTGTCCCTGGAGG + Intergenic
1062944405 10:1449642-1449664 CCATGAGGTCCTGACTCTCAGGG - Intronic
1063438399 10:6052939-6052961 CCTTGGGGTCTGGGTTCTCCGGG - Intronic
1063445873 10:6116344-6116366 CCTTGGGGTCATGTTTCTACTGG + Exonic
1065775215 10:29113454-29113476 CCTTTTGCTCCTGTTTCTCCAGG - Intergenic
1066048176 10:31612560-31612582 CTTTGGGTTCCTTTCCCTCCGGG - Intergenic
1068649084 10:59501576-59501598 CCTTGGGGTCCAGTCACAGCTGG + Intergenic
1068921854 10:62493222-62493244 CCTTGAAGTCCTGTCTTACCTGG - Intronic
1070629084 10:78071621-78071643 CCTTGGGTTCCTGTTGCTTCAGG + Intergenic
1070956913 10:80469919-80469941 CCTTGGTGTCCTGTCTCCAAGGG + Intronic
1074462131 10:113647593-113647615 CCTAGTGGTACTGTCTCCCCCGG + Intronic
1077642856 11:3897418-3897440 CTTTTGGGTCCTGTCTATTCTGG + Intronic
1077972803 11:7212981-7213003 CCTTGGGGACTTGTCTCTCATGG - Intergenic
1079289726 11:19176740-19176762 CCTTGGGTTCCTGTTGCTCTTGG + Intergenic
1079517827 11:21289532-21289554 CCTTGGGTGCCTGTATCACCAGG + Intronic
1082005275 11:47415713-47415735 CCTTGGGCTGCTCTCACTCCCGG - Exonic
1084410987 11:69005790-69005812 GCTGTGGGTCCTGTCCCTCCTGG - Exonic
1084903601 11:72328815-72328837 CCCTGGGCTCCAGTTTCTCCAGG + Intronic
1085188041 11:74592822-74592844 TCGTGGGGACCTGTCTCCCCTGG - Intronic
1088728839 11:112663068-112663090 CCTGGGGGTTCTGACTCTCAAGG - Intergenic
1089361276 11:117888412-117888434 CTTTGGGCTCCAGCCTCTCCAGG + Intergenic
1089981459 11:122776370-122776392 CTTTTGGCTCCTGTCTCTTCTGG - Intronic
1090188076 11:124751366-124751388 TCCTGGGCTCCTGTCCCTCCAGG + Intronic
1090514531 11:127411561-127411583 CCTTGGGGCCCTGTGGTTCCTGG - Intergenic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1092160329 12:6312160-6312182 CCTAGGGGACCTCTTTCTCCTGG + Exonic
1092492223 12:8956031-8956053 CCTTTGGGTCCCCTCTCTGCTGG + Intronic
1094819061 12:34210957-34210979 CCCGGGGGTCCTGTTGCTCCTGG + Intergenic
1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG + Intergenic
1095981578 12:47977466-47977488 CCTTCTGTTCCTGTCTCTTCTGG - Intronic
1096123405 12:49103091-49103113 CCTTGGGGTTCTGCTGCTCCTGG - Exonic
1096515429 12:52152706-52152728 CATTGGCGTCCTGCCTGTCCTGG + Intergenic
1096973370 12:55684736-55684758 CCTTGGGGTCCTGTTACACAGGG + Exonic
1097450627 12:59733547-59733569 CTTTGGGGCTCTGTGTCTCCTGG - Intronic
1100433453 12:94551016-94551038 CCTTAGGGTGTTTTCTCTCCAGG - Intergenic
1102201366 12:111059901-111059923 CCTTGGGATCCTGACTCACATGG + Intronic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1104475893 12:129069982-129070004 CGTTGGGGGCCTGTCCCTCGCGG - Intergenic
1104870939 12:131995110-131995132 CCTGGAGGTCCTGGCCCTCCTGG + Intronic
1106050011 13:26180970-26180992 ACTTGGGGTGCTGGCTGTCCAGG + Intronic
1106641216 13:31586526-31586548 CCTTGAGGTCCTGTCACTCTGGG - Intergenic
1107990675 13:45816297-45816319 CCTTGAGGCCCTGTTTCTGCTGG + Intronic
1108020874 13:46126692-46126714 CTTTAGGGTTCTGCCTCTCCAGG - Exonic
1113463080 13:110495437-110495459 CCTTGGTCTCCTTTCTGTCCTGG - Exonic
1116466751 14:45242176-45242198 CCTGGAAGACCTGTCTCTCCAGG + Exonic
1119619973 14:76124697-76124719 CCTTGGGGTCATGTTTCTTGTGG + Intergenic
1127732093 15:61810894-61810916 CCTTGGATTCCTGTCACCCCTGG + Intergenic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1129424256 15:75453108-75453130 CCTTGGGGTCTTAGCTCTCTGGG - Intronic
1130332209 15:82931266-82931288 CCCAGGGGGCCTGTCTCTCAAGG - Intronic
1131800996 15:96069433-96069455 ACTCGTGGTTCTGTCTCTCCTGG - Intergenic
1131996089 15:98134322-98134344 CCTGGGTCTCCTGTCTGTCCAGG - Intergenic
1132715447 16:1287967-1287989 GCTTGCGGTCGTGTTTCTCCAGG - Intergenic
1132927277 16:2437406-2437428 CCTTAGGCTCCTGACTTTCCAGG - Intronic
1133192916 16:4147554-4147576 CCTGGGGGGCCTCGCTCTCCTGG - Intergenic
1134132177 16:11657364-11657386 CCTTGGGGACCTGGGGCTCCTGG - Intergenic
1134237278 16:12476935-12476957 CCTTGGGGACTTTTCTCTCTGGG + Intronic
1135179515 16:20260665-20260687 CTTTGGGGTCCTCGGTCTCCAGG + Intergenic
1137044333 16:35642012-35642034 CCACGGGGCCCTGGCTCTCCTGG - Intergenic
1137588740 16:49680549-49680571 CCTTGGGGTTCTGTGGTTCCTGG + Intronic
1138299537 16:55914723-55914745 CTTTGGGATCGTGCCTCTCCAGG - Intronic
1138586776 16:57975837-57975859 CCTTGGGGGTCTGTCTCTAATGG + Intergenic
1138623344 16:58229951-58229973 CCTGGGGCTACTGTCTATCCAGG + Intergenic
1139687229 16:68613520-68613542 CCTTTGGGTCATTTCTCCCCAGG - Intergenic
1139923693 16:70474444-70474466 CTTTGGGGACCTGACTGTCCCGG - Intronic
1140046377 16:71442572-71442594 CCTGGGGGCCCTCTCTCTGCAGG - Intergenic
1141434201 16:83989975-83989997 CCTAGGGCTCCTGGATCTCCAGG - Intronic
1142247994 16:88978536-88978558 CCTGGGGGCCCTGACCCTCCTGG + Intergenic
1142366250 16:89651531-89651553 CTGTGGGGTCATGACTCTCCTGG - Intronic
1143071886 17:4302364-4302386 CCTTGGGTTGCTGTGTCTTCTGG + Intronic
1143314138 17:6018805-6018827 CCCCTGGCTCCTGTCTCTCCTGG + Intronic
1144384001 17:14731777-14731799 CCTTGGGCTACTGTCACTCATGG + Intergenic
1146225584 17:31063112-31063134 CCTTGGGCCCCTGTCTCTATTGG + Intergenic
1146621490 17:34401937-34401959 CCTTTGGGACCTCTCCCTCCAGG - Intergenic
1147833385 17:43312938-43312960 CCTAAGGCTCCTGTCTGTCCAGG - Intergenic
1147884020 17:43672459-43672481 CCCTGGTGTCCTGCCTCTCCTGG - Intergenic
1148913174 17:50954224-50954246 CCTCGGGGTCCCATCTCTCCAGG - Intergenic
1149517862 17:57294035-57294057 CTCTGTGGTACTGTCTCTCCAGG + Intronic
1150529274 17:65959619-65959641 CCTTGGGTTCCTGTGGTTCCTGG + Intronic
1150652293 17:67017981-67018003 CCTTTGGGGCATATCTCTCCCGG + Intronic
1151757386 17:76082612-76082634 CCATGGGGTGCAGCCTCTCCAGG - Exonic
1152281390 17:79386713-79386735 CCTTGGGGTCCAGCCCCTCCAGG + Intronic
1152534063 17:80940513-80940535 CCTTGCGGATCTGACTCTCCAGG - Exonic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1154192841 18:12244958-12244980 CCTTGGGGTTCTGTCATTTCAGG + Intergenic
1154400303 18:14030668-14030690 GCTTTGTGGCCTGTCTCTCCGGG - Intergenic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155300754 18:24426802-24426824 CGGCGGGGTGCTGTCTCTCCAGG + Intronic
1157228624 18:45891986-45892008 TGTTTGGCTCCTGTCTCTCCAGG - Intronic
1157574254 18:48733141-48733163 CCTTGGGATACTGCCTCCCCAGG - Intronic
1160682186 19:416954-416976 CCTGGGAGCCCTGACTCTCCGGG + Exonic
1161410028 19:4112036-4112058 GCTGGGGGTCCTGGCTCTTCTGG - Intronic
1161802069 19:6421821-6421843 CCTCAGGGGCCAGTCTCTCCTGG - Intronic
1162325726 19:9997982-9998004 ACTTGGGGTCCTGGGGCTCCTGG + Exonic
1162464624 19:10832381-10832403 CCTCGGGGGCCGGTCTGTCCTGG + Intronic
1162520285 19:11175657-11175679 CCTTGGGTTCCTGTTCTTCCTGG - Intronic
1163688966 19:18728190-18728212 CCCTGGTGTCCTGGCCCTCCCGG + Intronic
1164972261 19:32542669-32542691 ACTTCGGTTCCTGTCTATCCAGG - Intergenic
1166332306 19:42086076-42086098 CCTTGGTCTCCTCTCTGTCCTGG - Intergenic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1167622210 19:50566647-50566669 CCCTGGGGTCCTGTCCTGCCAGG - Intronic
1167622358 19:50567201-50567223 CCTTGGGCACGTGTCTCTCCAGG - Intronic
1167740905 19:51324482-51324504 TCTCCAGGTCCTGTCTCTCCAGG - Intronic
1168322499 19:55518439-55518461 CCTTGGAGTCCAGCCCCTCCAGG + Exonic
925418726 2:3692974-3692996 CCCTGATGTCCTGCCTCTCCTGG + Intronic
927096365 2:19750410-19750432 CCTTGGGATCCTGTCTCACCAGG - Intergenic
927786882 2:25980789-25980811 CCTTGGGGTCCTCGTTCACCCGG + Exonic
933722587 2:85407908-85407930 CCTTTTGTTCCAGTCTCTCCTGG + Intronic
936485863 2:112925199-112925221 CCTTGAGTTCCTGCCTCCCCTGG + Intergenic
937868295 2:126770118-126770140 CCTTGGGTGCCTTTATCTCCTGG + Intergenic
941022492 2:160423774-160423796 CCTTGAGGTCCTGTGTCCCCTGG + Intronic
941786123 2:169500442-169500464 CCTTGCTGTCCTCTCTGTCCTGG + Intronic
943529175 2:189057381-189057403 CCTGGTGGGCCTGTATCTCCAGG + Exonic
945626096 2:212208204-212208226 CCTTAGGGTCCTGTTTGCCCTGG + Intronic
946241621 2:218359509-218359531 CCCTGGGGGCCTGTTTCACCTGG - Intronic
947167868 2:227280916-227280938 CCTGGGGGTCCTTGTTCTCCAGG - Exonic
948215313 2:236224617-236224639 GCTTTGGGTCCTGGCTCTACTGG + Intronic
948352194 2:237350181-237350203 CCTTTTGGTCCTGGCTCTCCGGG + Exonic
948600254 2:239103853-239103875 CCTGGGGGTCCTGTCCATGCAGG + Intronic
948873051 2:240813221-240813243 CCTGGGGCTCCTTACTCTCCAGG - Intronic
948886548 2:240887850-240887872 CCTTGGGACCCTGTGTCCCCTGG - Intronic
1169670122 20:8090096-8090118 CCTTGGTTTCATGTCTCTCTGGG + Intergenic
1170341719 20:15336079-15336101 CCTTGGGGTTTTGTCTGGCCTGG - Intronic
1171143952 20:22765769-22765791 TCTTGGGGTGCTGGCTGTCCAGG + Intergenic
1172197271 20:33100510-33100532 CCTTGGGGTCCTGACGGTGCTGG + Intronic
1172347118 20:34210311-34210333 CTTTGGGGCCCTGTGACTCCTGG + Intronic
1172520958 20:35565140-35565162 CCTTGGTGTCCTGCCGCTCCCGG + Intergenic
1172650126 20:36496823-36496845 TCTTGTGGTCCTGGCTGTCCAGG - Exonic
1172836054 20:37873882-37873904 GCTTGGGGCCCTGTCCCTCAGGG - Intergenic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1175431604 20:58908710-58908732 TTTTGGGGTCCTTTCTCTACTGG + Intronic
1175683076 20:61005602-61005624 CCTTGGGCTCCTGTGTCTTCTGG - Intergenic
1175880791 20:62257623-62257645 CCTTGAGGTCCCTCCTCTCCTGG + Intronic
1179478983 21:41665940-41665962 CCATGGGGTCCTGGGTGTCCTGG + Intergenic
1180159501 21:45992754-45992776 CCCCGTGGTCCTCTCTCTCCAGG - Exonic
1180702787 22:17790782-17790804 CCTTGTCCTCCTCTCTCTCCCGG + Exonic
1181632172 22:24157042-24157064 CAACGCGGTCCTGTCTCTCCAGG - Intronic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1183530084 22:38348646-38348668 CCCAGGGGTCCTGACTCTCTTGG + Intronic
1184004286 22:41697260-41697282 CCCTGGTGGCCTGACTCTCCTGG - Exonic
1184305771 22:43600548-43600570 GCTTGGGTTGCTCTCTCTCCTGG - Intronic
1185305772 22:50115188-50115210 CCTGGGGGGCTTGTCCCTCCAGG + Exonic
950410626 3:12834092-12834114 ACTGGGGGCCCTGTCGCTCCTGG + Exonic
950692358 3:14670025-14670047 GCTTGGTGTCCTTCCTCTCCTGG - Exonic
953333284 3:42072236-42072258 CCTGGGAGTGCTGTCTCTCTCGG + Intronic
954133913 3:48573320-48573342 CCTGGAGGTCCTGTCTCTCCAGG + Exonic
954982830 3:54761689-54761711 CTTTGGGGCCCTGTTTCCCCTGG + Intronic
958890246 3:99775201-99775223 ACCTGGGCTCCAGTCTCTCCTGG + Intronic
958928706 3:100186659-100186681 ACTTGGGCTCTTGTCTTTCCTGG - Intronic
959041113 3:101424184-101424206 CCCTGGGGTCCTGTATCACTGGG + Intronic
961007966 3:123417415-123417437 CTCTGGGGACCTGTCTGTCCAGG - Intronic
961008195 3:123419107-123419129 CCTAAGGGTTCTGTTTCTCCAGG + Intronic
963009892 3:140759250-140759272 CCTGGCAGCCCTGTCTCTCCAGG + Intergenic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
964887131 3:161497150-161497172 CCTGGCTGTCCAGTCTCTCCAGG - Exonic
965371080 3:167863318-167863340 CCTGGGGGTCTTGTCTCCCAGGG + Intergenic
967471841 3:189870917-189870939 TCTTTGGGTCCTGACTCTCAGGG + Intronic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968516680 4:1018492-1018514 CCTTGGTGTCCTGCCTGTGCTGG + Intronic
976046727 4:80957215-80957237 GCTTGGAGTCCCATCTCTCCTGG + Intronic
982278266 4:153658825-153658847 CCTTGGAGTCCTTGCCCTCCCGG - Intergenic
982802445 4:159722058-159722080 CCTTGGGGTGTTGCCTTTCCAGG + Intergenic
985313588 4:188630953-188630975 CACTGGGCTCCTGTCTTTCCAGG + Intergenic
988689586 5:33559108-33559130 CCTCTGGGTCCTGTCTGTCTGGG + Intronic
988805919 5:34740613-34740635 CCTTGGAGGCCTGTGTCTTCTGG + Intronic
990302902 5:54466479-54466501 CTTTGGGTTCCTATCTCTTCCGG + Intergenic
995681667 5:114727370-114727392 CCTGGGGGTCCTCTCCCACCCGG - Intergenic
998401380 5:141850695-141850717 CATTGGGGTCGTGTTTCTCTTGG - Intergenic
999204314 5:149837125-149837147 CCTGGGGCTCCTGGCTCCCCGGG - Intronic
999666480 5:153917738-153917760 CCTTGGCTCTCTGTCTCTCCTGG + Intergenic
1000334130 5:160229356-160229378 CCTCGGGGCTCTGTCCCTCCAGG + Intronic
1000368051 5:160509273-160509295 CATTGGGGTCCTCTGACTCCTGG - Intergenic
1001278833 5:170371239-170371261 CCTCGTGGTCCTGTCTGTCTTGG + Intronic
1001781953 5:174376357-174376379 CCTTGGCGTTGTGTCACTCCAGG + Intergenic
1002317312 5:178351472-178351494 CCTGGGGGTCATTTCTCTGCTGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1005439055 6:25845516-25845538 ACTTGGGGTTTTGTGTCTCCAGG - Exonic
1005905632 6:30259996-30260018 CCTTGGCGTTCCGTGTCTCCTGG - Intergenic
1006295781 6:33169426-33169448 CCTGGTGGCCCTGGCTCTCCTGG + Exonic
1006295872 6:33169856-33169878 CCTGGAGATCCTGACTCTCCTGG + Exonic
1006296500 6:33172296-33172318 CCTGGGAGGCCTCTCTCTCCTGG + Exonic
1009924368 6:70102193-70102215 CCTGGGGGTCCTGGTTTTCCGGG - Exonic
1009931793 6:70184886-70184908 CCTTTGGGGCCTCTGTCTCCAGG - Exonic
1009933092 6:70199715-70199737 CCTTGGGGTCCAGGGTCTCCTGG - Exonic
1009937613 6:70252136-70252158 CCTCGGGGTCCCACCTCTCCTGG + Exonic
1009937914 6:70255344-70255366 CCTTTGGGACCTGCTTCTCCTGG + Exonic
1010511430 6:76725188-76725210 CCCTGGGATCCTGTCTCCACAGG + Intergenic
1013512703 6:110859022-110859044 ACTTGGGGTCATGTATCTGCCGG - Intronic
1013980471 6:116121745-116121767 CCATATGGTCCTCTCTCTCCTGG + Exonic
1014468075 6:121780904-121780926 CCTTGGCCTTCTGTCTCTTCTGG - Intergenic
1014720403 6:124911258-124911280 CTTGTGGCTCCTGTCTCTCCAGG - Intergenic
1015935320 6:138402704-138402726 CCTGGGGCTCCTGGCTCTCAGGG + Intergenic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1017645735 6:156538389-156538411 TCTTAGTGTCCTGTCTCTCCAGG - Intergenic
1017789097 6:157780087-157780109 CCTTGGGGTCCTGTCACCAGAGG - Intronic
1018370299 6:163162170-163162192 CCTGGCTGTCCTGGCTCTCCAGG - Intronic
1018979532 6:168592086-168592108 CCTTGGTGTCCTGTGTCTACCGG + Intronic
1019129636 6:169864336-169864358 CTCTGTGGACCTGTCTCTCCCGG - Intergenic
1019318205 7:401246-401268 CCTGGGGATCCTCCCTCTCCTGG + Intergenic
1019358557 7:593530-593552 CCTTGACGCCCTGTCGCTCCCGG - Intronic
1022236514 7:28467004-28467026 CCTTGGCCCCCTGTCCCTCCAGG - Intronic
1023868690 7:44251439-44251461 CCTTGGGCTCCTTTCTTTCTGGG - Intronic
1023940589 7:44766354-44766376 CCAAGGGGCCCTGTCTCCCCAGG + Intronic
1025035237 7:55589559-55589581 CCTAGGAGGCCTCTCTCTCCTGG - Intergenic
1025035802 7:55591903-55591925 CCTGGAGATCCTGACTCTCCTGG - Intergenic
1026491279 7:70866158-70866180 CCTGGGTGTCCTGGCACTCCAGG - Intergenic
1027869343 7:83686968-83686990 CCTTGGGCTGCTGTCCCTCTTGG + Intergenic
1029597160 7:101544003-101544025 CCTGGTGGTCCTGTCTGCCCCGG - Exonic
1030209944 7:106986347-106986369 CCTTGGACTCCTTTCTTTCCAGG - Intergenic
1032283283 7:130523418-130523440 CCTTGGGGTCCTGCATCCTCGGG + Intronic
1032284029 7:130527644-130527666 CCTTGGGGTCCTGCATCCTCGGG + Intronic
1032284801 7:130532021-130532043 CCTTGGGGTCCTGCATCCTCGGG + Intronic
1033441729 7:141386212-141386234 CCTTCAGCTCCTTTCTCTCCTGG + Intronic
1035042814 7:155942889-155942911 GCTTTGGGACCTGTCTCTCGGGG - Intergenic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1035374881 7:158401379-158401401 CCTTGGGGTCCAGCGGCTCCTGG - Intronic
1035471140 7:159109561-159109583 CATTTGGCTCCTGTCTCCCCTGG + Intronic
1035521005 8:274986-275008 CCTTGGGGTCCAGTTGCCCCAGG + Intergenic
1035742989 8:1943289-1943311 GAATGGGGCCCTGTCTCTCCTGG - Intronic
1036090882 8:5663978-5664000 CCCTGGGGTTCTGTCTTTCTGGG + Intergenic
1036184763 8:6613597-6613619 CCTTGGGCTCCTGTCTCCCCGGG - Intronic
1037976981 8:23220787-23220809 CCTTGCTGCCCTGTCACTCCTGG + Intronic
1041098530 8:54373473-54373495 CCCTGGGGTGCTGGCTCCCCGGG - Intergenic
1041615192 8:59898871-59898893 CCTTGGGTTCATGTCACTCCTGG - Intergenic
1042687759 8:71461488-71461510 CTTTGGGGTCCTGTGGTTCCTGG - Intronic
1042944898 8:74144970-74144992 CCCTGGGTTCCTTTCTCTTCTGG + Intergenic
1044923658 8:97190865-97190887 CTTAGGGGTCCTGTCACTGCTGG - Intergenic
1048846077 8:138604741-138604763 CCTGGGACTCCTTTCTCTCCTGG + Exonic
1050244733 9:3676819-3676841 CCAGGGAGTCCTGTGTCTCCAGG - Intergenic
1055405902 9:75973572-75973594 CCTTGGCCTCCTGGATCTCCGGG + Intronic
1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG + Intronic
1057173306 9:92976592-92976614 CCTTCGGGACCTGGCTGTCCAGG - Exonic
1057353564 9:94318715-94318737 CCCTGGGGTCCTCTCCCTCCTGG + Exonic
1057654187 9:96938877-96938899 CCCTGGGGTCCTCTCCCTCCTGG - Exonic
1058200258 9:102029195-102029217 CCTTGGCTTCCTGTCACTCCTGG + Intergenic
1058592194 9:106576715-106576737 CCTTGGGGTGCCCTCTGTCCAGG - Intergenic
1058818132 9:108704382-108704404 CCTGGATTTCCTGTCTCTCCAGG + Intergenic
1059431469 9:114252912-114252934 ACCTGGGGTCCAGGCTCTCCAGG - Exonic
1059751390 9:117250822-117250844 CCTTGGGGACCTTTCACCCCAGG - Intronic
1061116851 9:128619000-128619022 CCTTTGGTTTCTGTCTCACCTGG - Exonic
1061818597 9:133210135-133210157 CCTTGGGCACCTGGCTCTGCTGG + Intergenic
1061878593 9:133557211-133557233 CCTGGGGCTCCTGGCTCACCAGG - Intronic
1061916135 9:133755449-133755471 CCTCTGGGTCCAGCCTCTCCTGG - Intergenic
1062457563 9:136646706-136646728 CCCTGGGGTCCTGGCTGCCCTGG + Intergenic
1062590232 9:137271255-137271277 CCTCGGGGGCCTGGGTCTCCTGG + Intronic
1062601260 9:137319598-137319620 GCTTGGGGCCCTGGCCCTCCAGG + Intronic
1187268571 X:17759619-17759641 CCTTGGGGTCCTTGGACTCCTGG + Intergenic
1190304970 X:49076709-49076731 CCTTGGAGTCCTTGCCCTCCCGG + Exonic
1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG + Intergenic
1191877700 X:65812960-65812982 CCCTGTGTTCCTGTCACTCCAGG + Intergenic
1195104964 X:101594440-101594462 CCTTGGCTTCGTGTCGCTCCTGG + Intergenic
1195350242 X:103988654-103988676 CCTTTGTGTTTTGTCTCTCCTGG + Intergenic
1195791397 X:108591605-108591627 CCTTGGAGTCCTTTATCACCTGG - Exonic
1199513429 X:148648743-148648765 CCTTAGGTTTCTCTCTCTCCAGG - Intronic
1200084714 X:153598566-153598588 CCGAGGGTTCCTGTCACTCCGGG - Intronic